EMAIL THIS PAGE TO A FRIEND

PROCR

protein C receptor, endothelial

108 Gene Product Result for
Synonyms: CCCA CCD41 EPCR
UniProtKB ID: Q9UNN8, B2RC04, Q14218, Q6IB56, Q96CB3, Q9ULX1
Gene ID:
Human(10544) Summary: The protein encoded by this gene is a receptor for activated protein C, a serine protease activated by and involved in the blood coagulation pathway. The encoded protein is an N-glycosylated type I membrane protein that enhances the activation of protein C. Mutations in this gene have been associated with venous thromboembolism and myocardial infarction, as well as with late fetal loss during pregnancy. [provided by RefSeq, Jul 2008]
Mouse(19124) protein C receptor, endothelial
Rat(362248) protein C receptor, endothelial
naked mole-rat(101699200) protein C receptor, endothelial
domestic guinea pig(100731547) protein C receptor, endothelial
cow(282005) protein C receptor, endothelial
sheep(101115814) protein C receptor, endothelial
chicken(424867) protein C receptor, endothelial
domestic cat(101082897) protein C receptor, endothelial
dog(485848) protein C receptor, endothelial
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306489 ANTI-CD201 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
E6280 Anti-Endothelial Cell Protein C Receptor antibody, Rat monoclonal clone RCR-252, purified from hybridoma cell culture human
flow cytometry, microarray pricing
SAB1105071 Anti-PROCR (71-85) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
SAB1408776 Anti-PROCR antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA039461 Anti-PROCR antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunohistochemistry pricing
SAB4300625 Anti-PROCR antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB1410106 Anti-PROCR antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
E6405 Monoclonal Anti-Endothelial Cell Protein C Receptor antibody produced in rat clone RCR-379, purified immunoglobulin, buffered aqueous solution human
flow cytometry pricing
WH0010544M3 Monoclonal Anti-PROCR antibody produced in mouse clone M2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404841 Monoclonal Anti-PROCR antibody produced in mouse clone M1-5A10, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1408775 Monoclonal Anti-PROCR antibody produced in mouse clone M3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB1436 Human EPCR ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006404 Rosetta Predictions human pricing
NM_001025733 Rosetta Predictions rat pricing
NM_011171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00200403 predicted 550
2 SASI_Hs01_00200404 predicted 1104
3 SASI_Hs02_00341490 predicted 744
4 SASI_Hs01_00200405 predicted 1025
5 SASI_Hs01_00200406 predicted 363
6 SASI_Hs01_00200407 predicted 1119
7 SASI_Hs01_00200408 predicted 579
8 SASI_Hs02_00341491 predicted 644
9 SASI_Hs02_00341492 predicted 491
10 SASI_Hs01_00200409 predicted 691
11 SASI_Hs01_00200410 predicted 1133
12 SASI_Hs01_00200411 predicted 700
13 SASI_Hs01_00200412 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111599 predicted 643
2 SASI_Rn01_00111600 predicted 635
3 SASI_Rn01_00111601 predicted 892
4 SASI_Rn01_00111602 predicted 1033
5 SASI_Rn01_00111604 predicted 734
6 SASI_Rn01_00111605 predicted 658
7 SASI_Rn01_00111606 predicted 1004
8 SASI_Rn01_00111607 predicted 774
9 SASI_Rn01_00111608 predicted 769
10 SASI_Rn02_00203371 predicted 535
11 SASI_Rn01_00111603 predicted 439
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169211 predicted 886
2 SASI_Mm01_00169212 predicted 774
3 SASI_Mm01_00169213 predicted 1000
4 SASI_Mm01_00169214 predicted 986
5 SASI_Mm01_00169215 predicted 955
6 SASI_Mm01_00169216 predicted 1048
7 SASI_Mm01_00169217 predicted 1025
8 SASI_Mm01_00169218 predicted 566
9 SASI_Mm01_00169219 predicted 346
10 SASI_Mm01_00169220 predicted 1036
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006404
VALIDATED
PROCR MISSION shRNA Bacterial Glycerol Stock
protein C receptor, endothelial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-1225s21c1
Sequence:CCGGGAATCACCTGAGGCGTTCAAACTCGAGTTTGAACGCCTCAGGTGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-1123s21c1
Sequence:CCGGTTTGCTGAATTAGTCTGATAACTCGAGTTATCAGACTAATTCAGCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006404.3-706s21c1
Sequence:CCGGTCGGTATGAACTGCGGGAATTCTCGAGAATTCCCGCAGTTCATACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-253s21c1
Sequence:CCGGTGGCCTCCAAAGACTTCATATCTCGAGATATGAAGTCTTTGGAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-679s21c1
Sequence:CCGGGCAGCAGCTCAATGCCTACAACTCGAGTTGTAGGCATTGAGCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006404.3-253s1c1
Sequence:CCGGTGGCCTCCAAAGACTTCATATCTCGAGATATGAAGTCTTTGGAGGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006404.3-706s1c1
Sequence:CCGGTCGGTATGAACTGCGGGAATTCTCGAGAATTCCCGCAGTTCATACCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006404.3-560s1c1
Sequence:CCGGAGAGCCCATGTCTTCTTCGAACTCGAGTTCGAAGAAGACATGGGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006404.3-679s1c1
Sequence:CCGGGCAGCAGCTCAATGCCTACAACTCGAGTTGTAGGCATTGAGCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006404.3-743s1c1
Sequence:CCGGGTGCAGTATGTGCAGAAACATCTCGAGATGTTTCTGCACATACTGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006404
VALIDATED
PROCR MISSION shRNA shRNA Plasmid DNA
protein C receptor, endothelial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-1225s21c1
Sequence:CCGGGAATCACCTGAGGCGTTCAAACTCGAGTTTGAACGCCTCAGGTGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-1123s21c1
Sequence:CCGGTTTGCTGAATTAGTCTGATAACTCGAGTTATCAGACTAATTCAGCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006404.3-706s21c1
Sequence:CCGGTCGGTATGAACTGCGGGAATTCTCGAGAATTCCCGCAGTTCATACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-253s21c1
Sequence:CCGGTGGCCTCCAAAGACTTCATATCTCGAGATATGAAGTCTTTGGAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-679s21c1
Sequence:CCGGGCAGCAGCTCAATGCCTACAACTCGAGTTGTAGGCATTGAGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006404.3-253s1c1
Sequence:CCGGTGGCCTCCAAAGACTTCATATCTCGAGATATGAAGTCTTTGGAGGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006404.3-706s1c1
Sequence:CCGGTCGGTATGAACTGCGGGAATTCTCGAGAATTCCCGCAGTTCATACCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006404.3-560s1c1
Sequence:CCGGAGAGCCCATGTCTTCTTCGAACTCGAGTTCGAAGAAGACATGGGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006404.3-679s1c1
Sequence:CCGGGCAGCAGCTCAATGCCTACAACTCGAGTTGTAGGCATTGAGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000061379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006404.3-743s1c1
Sequence:CCGGGTGCAGTATGTGCAGAAACATCTCGAGATGTTTCTGCACATACTGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006404
VALIDATED
PROCR MISSION shRNA Lentiviral Transduction Particles
protein C receptor, endothelial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377417    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-1225s21c1
Sequence:CCGGGAATCACCTGAGGCGTTCAAACTCGAGTTTGAACGCCTCAGGTGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-1123s21c1
Sequence:CCGGTTTGCTGAATTAGTCTGATAACTCGAGTTATCAGACTAATTCAGCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006404.3-706s21c1
Sequence:CCGGTCGGTATGAACTGCGGGAATTCTCGAGAATTCCCGCAGTTCATACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-253s21c1
Sequence:CCGGTGGCCTCCAAAGACTTCATATCTCGAGATATGAAGTCTTTGGAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006404.3-679s21c1
Sequence:CCGGGCAGCAGCTCAATGCCTACAACTCGAGTTGTAGGCATTGAGCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_006404.3-253s1c1
Sequence:CCGGTGGCCTCCAAAGACTTCATATCTCGAGATATGAAGTCTTTGGAGGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_006404.3-706s1c1
Sequence:CCGGTCGGTATGAACTGCGGGAATTCTCGAGAATTCCCGCAGTTCATACCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006404.3-560s1c1
Sequence:CCGGAGAGCCCATGTCTTCTTCGAACTCGAGTTCGAAGAAGACATGGGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006404.3-679s1c1
Sequence:CCGGGCAGCAGCTCAATGCCTACAACTCGAGTTGTAGGCATTGAGCTGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000061379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006404.3-743s1c1
Sequence:CCGGGTGCAGTATGTGCAGAAACATCTCGAGATGTTTCTGCACATACTGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011171
VALIDATED
PROCR MISSION shRNA Bacterial Glycerol Stock
protein C receptor, endothelial
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-456s21c1
Sequence:CCGGTCTTCGATGTGGCCGTGAATGCTCGAGCATTCACGGCCACATCGAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.2-797s21c1
Sequence:CCGGAGCCAAACAGGTCGCTCTTACCTCGAGGTAAGAGCGACCTGTTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-889s21c1
Sequence:CCGGCCATCACATCTCAGGAGGTTACTCGAGTAACCTCCTGAGATGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-362s21c1
Sequence:CCGGCGCAAGGAGAACGTGTTCTTTCTCGAGAAAGAACACGTTCTCCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-590s21c1
Sequence:CCGGCGGTATGAACTGCAGGAATTTCTCGAGAAATTCCTGCAGTTCATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011171.1-889s1c1
Sequence:CCGGCCATCACATCTCAGGAGGTTACTCGAGTAACCTCCTGAGATGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-712s1c1
Sequence:CCGGCCTGATGGGCTGTTTCATAATCTCGAGATTATGAAACAGCCCATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-590s1c1
Sequence:CCGGCGGTATGAACTGCAGGAATTTCTCGAGAAATTCCTGCAGTTCATACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-362s1c1
Sequence:CCGGCGCAAGGAGAACGTGTTCTTTCTCGAGAAAGAACACGTTCTCCTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-535s1c1
Sequence:CCGGGCCCTCCAAAGCAGCCAACTTCTCGAGAAGTTGGCTGCTTTGGAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011171
VALIDATED
PROCR MISSION shRNA shRNA Plasmid DNA
protein C receptor, endothelial
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-456s21c1
Sequence:CCGGTCTTCGATGTGGCCGTGAATGCTCGAGCATTCACGGCCACATCGAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.2-797s21c1
Sequence:CCGGAGCCAAACAGGTCGCTCTTACCTCGAGGTAAGAGCGACCTGTTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-889s21c1
Sequence:CCGGCCATCACATCTCAGGAGGTTACTCGAGTAACCTCCTGAGATGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-362s21c1
Sequence:CCGGCGCAAGGAGAACGTGTTCTTTCTCGAGAAAGAACACGTTCTCCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-590s21c1
Sequence:CCGGCGGTATGAACTGCAGGAATTTCTCGAGAAATTCCTGCAGTTCATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011171.1-889s1c1
Sequence:CCGGCCATCACATCTCAGGAGGTTACTCGAGTAACCTCCTGAGATGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-712s1c1
Sequence:CCGGCCTGATGGGCTGTTTCATAATCTCGAGATTATGAAACAGCCCATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-590s1c1
Sequence:CCGGCGGTATGAACTGCAGGAATTTCTCGAGAAATTCCTGCAGTTCATACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-362s1c1
Sequence:CCGGCGCAAGGAGAACGTGTTCTTTCTCGAGAAAGAACACGTTCTCCTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000119645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-535s1c1
Sequence:CCGGGCCCTCCAAAGCAGCCAACTTCTCGAGAAGTTGGCTGCTTTGGAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011171
VALIDATED
PROCR MISSION shRNA Lentiviral Transduction Particles
protein C receptor, endothelial
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-456s21c1
Sequence:CCGGTCTTCGATGTGGCCGTGAATGCTCGAGCATTCACGGCCACATCGAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.2-797s21c1
Sequence:CCGGAGCCAAACAGGTCGCTCTTACCTCGAGGTAAGAGCGACCTGTTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323660    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-889s21c1
Sequence:CCGGCCATCACATCTCAGGAGGTTACTCGAGTAACCTCCTGAGATGTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-362s21c1
Sequence:CCGGCGCAAGGAGAACGTGTTCTTTCTCGAGAAAGAACACGTTCTCCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011171.1-590s21c1
Sequence:CCGGCGGTATGAACTGCAGGAATTTCTCGAGAAATTCCTGCAGTTCATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119642    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011171.1-889s1c1
Sequence:CCGGCCATCACATCTCAGGAGGTTACTCGAGTAACCTCCTGAGATGTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-712s1c1
Sequence:CCGGCCTGATGGGCTGTTTCATAATCTCGAGATTATGAAACAGCCCATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-590s1c1
Sequence:CCGGCGGTATGAACTGCAGGAATTTCTCGAGAAATTCCTGCAGTTCATACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-362s1c1
Sequence:CCGGCGCAAGGAGAACGTGTTCTTTCTCGAGAAAGAACACGTTCTCCTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011171.1-535s1c1
Sequence:CCGGGCCCTCCAAAGCAGCCAACTTCTCGAGAAGTTGGCTGCTTTGGAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)