EMAIL THIS PAGE TO A FRIEND

PROK1

prokineticin 1

60 Gene Product Result for
Synonyms: EGVEGF PK1 PRK1
UniProtKB ID: P58294, Q5VWD4, Q8TC69
Gene ID:
Human(84432) Summary: The protein encoded by this gene induces proliferation, migration, and fenestration (the formation of membrane discontinuities) in capillary endothelial cells derived from endocrine glands. It has little or no effect on a variety of other endothelial and non-endothelial cell types. Its expression is restricted to the steroidogenic glands (ovary, testis, adrenal, and placenta), is induced by hypoxia, and often complementary to the expression of vascular endothelial growth factor (VEGF), suggesting that these molecules function in a coordinated manner. [provided by RefSeq, Sep 2011]
Mouse(246691) prokineticin 1
Rat(192205) prokineticin 1
cow(617599) prokineticin 1
sheep(101111502) prokineticin 1
naked mole-rat(101716639) prokineticin 1
Zebrafish(100126018) prokineticin 1
chicken(428257) prokineticin 1
domestic cat(101083097) prokineticin 1
dog(490113) prokineticin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001044382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001044382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001044382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032414 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032414 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032414 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032414 Rosetta Predictions human pricing
NM_138851 Rosetta Predictions rat pricing
NM_001044382 Rosetta Predictions mouse pricing
XM_900104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032414 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222283 predicted 520
2 SASI_Hs01_00222284 predicted 800
3 SASI_Hs01_00222285 predicted 822
4 SASI_Hs01_00222286 predicted 850
5 SASI_Hs01_00222287 predicted 716
6 SASI_Hs01_00222288 predicted 813
7 SASI_Hs01_00222289 predicted 837
8 SASI_Hs01_00222290 predicted 673
9 SASI_Hs01_00222291 predicted 823
10 SASI_Hs01_00222292 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138851 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063677 predicted 283
2 SASI_Rn01_00063678 predicted 185
3 SASI_Rn01_00063679 predicted 194
4 SASI_Rn01_00063680 predicted 195
5 SASI_Rn01_00063681 predicted 42
6 SASI_Rn01_00063682 predicted 169
7 SASI_Rn01_00063683 predicted 9
8 SASI_Rn01_00063685 predicted 188
9 SASI_Rn01_00063686 predicted 72
10 SASI_Rn02_00268244 predicted 36
11 SASI_Rn01_00063684 predicted 180
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291244 predicted 59
2 SASI_Mm02_00291245 predicted 154
3 SASI_Mm02_00291246 predicted 128
4 SASI_Mm02_00291247 predicted 68
5 SASI_Mm02_00291248 predicted 61
6 SASI_Mm02_00291249 predicted 98
7 SASI_Mm02_00291250 predicted 62
8 SASI_Mm02_00291251 predicted 95
9 SASI_Mm02_00291252 predicted 353
10 SASI_Mm02_00291253 predicted 56
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226520 predicted 701
2 SASI_Mm01_00226521 predicted 543
3 SASI_Mm01_00226522 predicted 506
4 SASI_Mm01_00226523 predicted 330
5 SASI_Mm01_00226524 predicted 591
6 SASI_Mm01_00226525 predicted 635
7 SASI_Mm01_00226526 predicted 275
8 SASI_Mm01_00226527 predicted 477
9 SASI_Mm01_00226528 predicted 700
10 SASI_Mm01_00226529 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001044382
PROK1 MISSION shRNA Bacterial Glycerol Stock
prokineticin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-107s21c1
Sequence:CCGGTCCGACTGTGCGGTCATCACACTCGAGTGTGATGACCGCACAGTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-135s21c1
Sequence:CCGGGTGAACGAGATATCCAGTGTGCTCGAGCACACTGGATATCTCGTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-239s21c1
Sequence:CCGGCACCCAGGAAGCCACAAGATCCTCGAGGATCTTGTGGCTTCCTGGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-84s21c1
Sequence:CCGGTCATGCTCCTTCTAGCAACGGCTCGAGCCGTTGCTAGAAGGAGCATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-163s21c1
Sequence:CCGGCACCTGCTGCGCTATCAGTCTCTCGAGAGACTGATAGCGCAGCAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001044382
PROK1 MISSION shRNA shRNA Plasmid DNA
prokineticin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-107s21c1
Sequence:CCGGTCCGACTGTGCGGTCATCACACTCGAGTGTGATGACCGCACAGTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-135s21c1
Sequence:CCGGGTGAACGAGATATCCAGTGTGCTCGAGCACACTGGATATCTCGTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-239s21c1
Sequence:CCGGCACCCAGGAAGCCACAAGATCCTCGAGGATCTTGTGGCTTCCTGGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-84s21c1
Sequence:CCGGTCATGCTCCTTCTAGCAACGGCTCGAGCCGTTGCTAGAAGGAGCATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000254138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-163s21c1
Sequence:CCGGCACCTGCTGCGCTATCAGTCTCTCGAGAGACTGATAGCGCAGCAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001044382
PROK1 MISSION shRNA Lentiviral Transduction Particles
prokineticin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-107s21c1
Sequence:CCGGTCCGACTGTGCGGTCATCACACTCGAGTGTGATGACCGCACAGTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-135s21c1
Sequence:CCGGGTGAACGAGATATCCAGTGTGCTCGAGCACACTGGATATCTCGTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367354    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-239s21c1
Sequence:CCGGCACCCAGGAAGCCACAAGATCCTCGAGGATCTTGTGGCTTCCTGGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-84s21c1
Sequence:CCGGTCATGCTCCTTCTAGCAACGGCTCGAGCCGTTGCTAGAAGGAGCATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000254138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001044382.1-163s21c1
Sequence:CCGGCACCTGCTGCGCTATCAGTCTCTCGAGAGACTGATAGCGCAGCAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032414
PROK1 MISSION shRNA Bacterial Glycerol Stock
prokineticin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000152928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-91s1c1
Sequence:CCGGCTAGTAACTGTGTCTGACTGTCTCGAGACAGTCAGACACAGTTACTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-344s1c1
Sequence:CCGGCCATGGACTTGAAGAACATCACTCGAGTGATGTTCTTCAAGTCCATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-94s1c1
Sequence:CCGGGTAACTGTGTCTGACTGTGCTCTCGAGAGCACAGTCAGACACAGTTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-87s1c1
Sequence:CCGGCCTCCTAGTAACTGTGTCTGACTCGAGTCAGACACAGTTACTAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-342s1c1
Sequence:CCGGCTCCATGGACTTGAAGAACATCTCGAGATGTTCTTCAAGTCCATGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-88s1c1
Sequence:CCGGCTCCTAGTAACTGTGTCTGACCTCGAGGTCAGACACAGTTACTAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-345s1c1
Sequence:CCGGCATGGACTTGAAGAACATCAACTCGAGTTGATGTTCTTCAAGTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-90s1c1
Sequence:CCGGCCTAGTAACTGTGTCTGACTGCTCGAGCAGTCAGACACAGTTACTAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-81s1c1
Sequence:CCGGCATGCTCCTCCTAGTAACTGTCTCGAGACAGTTACTAGGAGGAGCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032414
PROK1 MISSION shRNA shRNA Plasmid DNA
prokineticin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000152928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-91s1c1
Sequence:CCGGCTAGTAACTGTGTCTGACTGTCTCGAGACAGTCAGACACAGTTACTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-344s1c1
Sequence:CCGGCCATGGACTTGAAGAACATCACTCGAGTGATGTTCTTCAAGTCCATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-94s1c1
Sequence:CCGGGTAACTGTGTCTGACTGTGCTCTCGAGAGCACAGTCAGACACAGTTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-87s1c1
Sequence:CCGGCCTCCTAGTAACTGTGTCTGACTCGAGTCAGACACAGTTACTAGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-342s1c1
Sequence:CCGGCTCCATGGACTTGAAGAACATCTCGAGATGTTCTTCAAGTCCATGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-88s1c1
Sequence:CCGGCTCCTAGTAACTGTGTCTGACCTCGAGGTCAGACACAGTTACTAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-345s1c1
Sequence:CCGGCATGGACTTGAAGAACATCAACTCGAGTTGATGTTCTTCAAGTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-90s1c1
Sequence:CCGGCCTAGTAACTGTGTCTGACTGCTCGAGCAGTCAGACACAGTTACTAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-81s1c1
Sequence:CCGGCATGCTCCTCCTAGTAACTGTCTCGAGACAGTTACTAGGAGGAGCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032414
PROK1 MISSION shRNA Lentiviral Transduction Particles
prokineticin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000152928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-91s1c1
Sequence:CCGGCTAGTAACTGTGTCTGACTGTCTCGAGACAGTCAGACACAGTTACTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-344s1c1
Sequence:CCGGCCATGGACTTGAAGAACATCACTCGAGTGATGTTCTTCAAGTCCATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-94s1c1
Sequence:CCGGGTAACTGTGTCTGACTGTGCTCTCGAGAGCACAGTCAGACACAGTTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-87s1c1
Sequence:CCGGCCTCCTAGTAACTGTGTCTGACTCGAGTCAGACACAGTTACTAGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-342s1c1
Sequence:CCGGCTCCATGGACTTGAAGAACATCTCGAGATGTTCTTCAAGTCCATGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-88s1c1
Sequence:CCGGCTCCTAGTAACTGTGTCTGACCTCGAGGTCAGACACAGTTACTAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-345s1c1
Sequence:CCGGCATGGACTTGAAGAACATCAACTCGAGTTGATGTTCTTCAAGTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-90s1c1
Sequence:CCGGCCTAGTAACTGTGTCTGACTGCTCGAGCAGTCAGACACAGTTACTAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032414.1-81s1c1
Sequence:CCGGCATGCTCCTCCTAGTAACTGTCTCGAGACAGTTACTAGGAGGAGCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)