EMAIL THIS PAGE TO A FRIEND

PROKR1

prokineticin receptor 1

81 Gene Product Result for
Synonyms: GPR73 GPR73a PKR1 ZAQ
UniProtKB ID: Q8TCW9, A5JUU2, Q53QT9, Q8NFJ7
Gene ID:
Mouse(58182) prokineticin receptor 1
Rat(192648) prokineticin receptor 1
cow(281800) prokineticin receptor 1
sheep(101109687) prokineticin receptor 1
domestic guinea pig(100729347) prokineticin receptor 1
naked mole-rat(101704454) prokineticin receptor 1
Domestic Rabbit(100342523) prokineticin receptor 1
dog(481406) prokineticin receptor 1
domestic cat(101091781) prokineticin receptor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138964 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021381 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021381 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021381 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031271 MISSION® esiRNA esiRNA targeting mouse Prokr1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138964 Rosetta Predictions human pricing
NM_138977 Rosetta Predictions rat pricing
NM_021381 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173786 predicted 692
2 SASI_Hs01_00173788 predicted 437
3 SASI_Hs01_00173789 predicted 227
4 SASI_Hs01_00173790 predicted 350
5 SASI_Hs01_00173791 predicted 216
6 SASI_Hs01_00173792 predicted 543
7 SASI_Hs01_00173793 predicted 220
8 SASI_Hs01_00173794 predicted 404
9 SASI_Hs01_00173795 predicted 520
10 SASI_Hs02_00364016 predicted 1077
11 SASI_Hs01_00173787 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138977 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077665 predicted 595
2 SASI_Rn01_00077666 predicted 455
3 SASI_Rn01_00077667 predicted 460
4 SASI_Rn01_00077668 predicted 402
5 SASI_Rn02_00268410 predicted 223
6 SASI_Rn01_00077669 predicted 498
7 SASI_Rn01_00077670 predicted 465
8 SASI_Rn01_00077671 predicted 710
9 SASI_Rn01_00077672 predicted 285
10 SASI_Rn01_00077673 predicted 891
11 SASI_Rn01_00077674 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021381 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147572 predicted 1503
2 SASI_Mm01_00147574 predicted 1572
3 SASI_Mm01_00147575 predicted 970
4 SASI_Mm01_00147576 predicted 1629
5 SASI_Mm02_00325972 predicted 347
6 SASI_Mm01_00147577 predicted 1562
7 SASI_Mm01_00147579 predicted 1648
8 SASI_Mm01_00147581 predicted 1667
9 SASI_Mm02_00325973 predicted 1286
10 SASI_Mm02_00325974 predicted 1534
11 SASI_Mm01_00147573 predicted 1287
12 SASI_Mm01_00147578 predicted 1516
13 SASI_Mm01_00147580 predicted 1552
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138964
PROKR1 MISSION shRNA Bacterial Glycerol Stock
prokineticin receptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-107s21c1
Sequence:CCGGACTTCAGCTACAGCGACTATGCTCGAGCATAGTCGCTGTAGCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-158s21c1
Sequence:CCGGCCAATTCCAGGACGTTCTTTGCTCGAGCAAAGAACGTCCTGGAATTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-228s1c1
Sequence:CCGGCGGCATTGGAAACTTCATCTTCTCGAGAAGATGAAGTTTCCAATGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-350s21c1
Sequence:CCGGCCTTTGAGATGGACTACTATGCTCGAGCATAGTAGTCCATCTCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-84s1c1
Sequence:CCGGCCATGCCACTTCCTTCCCATTCTCGAGAATGGGAAGGAAGTGGCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-1032s1c1
Sequence:CCGGCGTCAAGAACGACACCGTCAACTCGAGTTGACGGTGTCGTTCTTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-700s1c1
Sequence:CCGGCTCTTTATCTTTGGCATAGAACTCGAGTTCTATGCCAAAGATAAAGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-117s1c1
Sequence:CCGGCAGCGACTATGATATGCCTTTCTCGAGAAAGGCATATCATAGTCGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-472s21c1
Sequence:CCGGATCGCCATTGACAGGTATCTGCTCGAGCAGATACCTGTCAATGGCGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138964
PROKR1 MISSION shRNA shRNA Plasmid DNA
prokineticin receptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-107s21c1
Sequence:CCGGACTTCAGCTACAGCGACTATGCTCGAGCATAGTCGCTGTAGCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-158s21c1
Sequence:CCGGCCAATTCCAGGACGTTCTTTGCTCGAGCAAAGAACGTCCTGGAATTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-228s1c1
Sequence:CCGGCGGCATTGGAAACTTCATCTTCTCGAGAAGATGAAGTTTCCAATGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-350s21c1
Sequence:CCGGCCTTTGAGATGGACTACTATGCTCGAGCATAGTAGTCCATCTCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-84s1c1
Sequence:CCGGCCATGCCACTTCCTTCCCATTCTCGAGAATGGGAAGGAAGTGGCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-1032s1c1
Sequence:CCGGCGTCAAGAACGACACCGTCAACTCGAGTTGACGGTGTCGTTCTTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-700s1c1
Sequence:CCGGCTCTTTATCTTTGGCATAGAACTCGAGTTCTATGCCAAAGATAAAGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000008908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-117s1c1
Sequence:CCGGCAGCGACTATGATATGCCTTTCTCGAGAAAGGCATATCATAGTCGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-472s21c1
Sequence:CCGGATCGCCATTGACAGGTATCTGCTCGAGCAGATACCTGTCAATGGCGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138964
PROKR1 MISSION shRNA Lentiviral Transduction Particles
prokineticin receptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367715    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-107s21c1
Sequence:CCGGACTTCAGCTACAGCGACTATGCTCGAGCATAGTCGCTGTAGCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-158s21c1
Sequence:CCGGCCAATTCCAGGACGTTCTTTGCTCGAGCAAAGAACGTCCTGGAATTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-228s1c1
Sequence:CCGGCGGCATTGGAAACTTCATCTTCTCGAGAAGATGAAGTTTCCAATGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357322    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-350s21c1
Sequence:CCGGCCTTTGAGATGGACTACTATGCTCGAGCATAGTAGTCCATCTCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-84s1c1
Sequence:CCGGCCATGCCACTTCCTTCCCATTCTCGAGAATGGGAAGGAAGTGGCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-1032s1c1
Sequence:CCGGCGTCAAGAACGACACCGTCAACTCGAGTTGACGGTGTCGTTCTTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-700s1c1
Sequence:CCGGCTCTTTATCTTTGGCATAGAACTCGAGTTCTATGCCAAAGATAAAGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000008908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138964.2-117s1c1
Sequence:CCGGCAGCGACTATGATATGCCTTTCTCGAGAAAGGCATATCATAGTCGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138964.2-472s21c1
Sequence:CCGGATCGCCATTGACAGGTATCTGCTCGAGCAGATACCTGTCAATGGCGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021381
PROKR1 MISSION shRNA Bacterial Glycerol Stock
prokineticin receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000028684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-804s1c1
Sequence:CCGGGTGGTCAGTATCCATCCTCATCTCGAGATGAGGATGGATACTGACCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-1281s1c1
Sequence:CCGGCAGGAATAACACCAGTAAGTACTCGAGTACTTACTGGTGTTATTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-659s1c1
Sequence:CCGGCCTCTGTCAACTACTTGCGTACTCGAGTACGCAAGTAGTTGACAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-336s1c1
Sequence:CCGGCGGCTCGTTACCATTCACTTTCTCGAGAAAGTGAATGGTAACGAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-922s1c1
Sequence:CCGGCAGTTCTACTACAGGTCCTATCTCGAGATAGGACCTGTAGTAGAACTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021381
PROKR1 MISSION shRNA shRNA Plasmid DNA
prokineticin receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000028684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-804s1c1
Sequence:CCGGGTGGTCAGTATCCATCCTCATCTCGAGATGAGGATGGATACTGACCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-1281s1c1
Sequence:CCGGCAGGAATAACACCAGTAAGTACTCGAGTACTTACTGGTGTTATTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-659s1c1
Sequence:CCGGCCTCTGTCAACTACTTGCGTACTCGAGTACGCAAGTAGTTGACAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-336s1c1
Sequence:CCGGCGGCTCGTTACCATTCACTTTCTCGAGAAAGTGAATGGTAACGAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000028669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-922s1c1
Sequence:CCGGCAGTTCTACTACAGGTCCTATCTCGAGATAGGACCTGTAGTAGAACTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021381
PROKR1 MISSION shRNA Lentiviral Transduction Particles
prokineticin receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000028684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-804s1c1
Sequence:CCGGGTGGTCAGTATCCATCCTCATCTCGAGATGAGGATGGATACTGACCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028748    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-1281s1c1
Sequence:CCGGCAGGAATAACACCAGTAAGTACTCGAGTACTTACTGGTGTTATTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-659s1c1
Sequence:CCGGCCTCTGTCAACTACTTGCGTACTCGAGTACGCAAGTAGTTGACAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-336s1c1
Sequence:CCGGCGGCTCGTTACCATTCACTTTCTCGAGAAAGTGAATGGTAACGAGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000028669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021381.3-922s1c1
Sequence:CCGGCAGTTCTACTACAGGTCCTATCTCGAGATAGGACCTGTAGTAGAACTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)