EMAIL THIS PAGE TO A FRIEND

PROM1

prominin 1

64 Gene Product Result for
Synonyms: AC133 CD133 CORD12 MCDR2 PROML1 RP41 STGD4
Gene ID:
Human(8842) Summary: This gene encodes a pentaspan transmembrane glycoprotein. The protein localizes to membrane protrusions and is often expressed on adult stem cells, where it is thought to function in maintaining stem cell properties by suppressing differentiation. Mutations in this gene have been shown to result in retinitis pigmentosa and Stargardt disease. Expression of this gene is also associated with several types of cancer. This gene is expressed from at least five alternative promoters that are expressed in a tissue-dependent manner. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(19126) prominin 1
Rat(60357) prominin 1
chicken(422825) prominin 1
dog(488816) prominin 1
Horse(100068865) prominin 1
cow(618054) prominin 1
sheep(101107197) prominin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108441 Anti-PROM1 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, human, horse
western blot pricing
SAB2107606 Anti-PROM1 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, horse, mouse
ELISA, western blot pricing
SAB4300882 Anti-PROM1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006017 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006017 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006017 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006017 Rosetta Predictions human pricing
NM_001110137 Rosetta Predictions rat pricing
NM_021751 Rosetta Predictions rat pricing
NM_008935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006017 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00100511 predicted 1119
2 SASI_Hs02_00340735 predicted 1183
3 SASI_Hs01_00100512 predicted 575
4 SASI_Hs01_00100513 predicted 2150
5 SASI_Hs01_00100514 predicted 348
6 SASI_Hs01_00100515 predicted 799
7 SASI_Hs01_00100516 predicted 1210
8 SASI_Hs01_00100517 predicted 1935
9 SASI_Hs01_00100519 predicted 715
10 SASI_Hs01_00100520 predicted 2130
11 SASI_Hs01_00100518 predicted 2582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251012 predicted 1742
2 SASI_Rn02_00251013 predicted 1282
3 SASI_Rn02_00251014 predicted 2212
4 SASI_Rn02_00251015 predicted 1305
5 SASI_Rn02_00251016 predicted 2122
6 SASI_Rn02_00251017 predicted 1899
7 SASI_Rn02_00251018 predicted 2004
8 SASI_Rn02_00251019 predicted 1206
9 SASI_Rn02_00251020 predicted 1988
10 SASI_Rn02_00251021 predicted 1977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021751 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090988 predicted 1807
2 SASI_Rn02_00262807 predicted 1348
3 SASI_Rn02_00262808 predicted 2276
4 SASI_Rn01_00090992 predicted 1368
5 SASI_Rn02_00262809 predicted 2185
6 SASI_Rn02_00262810 predicted 1960
7 SASI_Rn01_00090993 predicted 2071
8 SASI_Rn01_00090994 predicted 1277
9 SASI_Rn01_00090995 predicted 2059
10 SASI_Rn01_00090996 predicted 2042
11 SASI_Rn01_00090987 predicted 1804
12 SASI_Rn01_00090989 predicted 1911
13 SASI_Rn01_00090990 predicted 383
14 SASI_Rn01_00090991 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00057491 predicted 382
2 SASI_Mm01_00057492 predicted 2082
3 SASI_Mm01_00057493 predicted 2679
4 SASI_Mm01_00057494 predicted 2573
5 SASI_Mm01_00057495 predicted 2279
6 SASI_Mm01_00057496 predicted 1319
7 SASI_Mm01_00057497 predicted 663
8 SASI_Mm01_00057498 predicted 1099
9 SASI_Mm01_00057499 predicted 1366
10 SASI_Mm01_00057500 predicted 2490
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006017
PROM1 MISSION shRNA Bacterial Glycerol Stock
prominin 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006017.2-1231s21c1
Sequence:CCGGCAGAACTTGACAACGTTAATACTCGAGTATTAACGTTGTCAAGTTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006017.2-404s21c1
Sequence:CCGGTGTGGTACAGCCGCGTGATTTCTCGAGAAATCACGCGGCTGTACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006017.2-3236s21c1
Sequence:CCGGGTGTACAGTAAACGGTGTATACTCGAGTATACACCGTTTACTGTACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-776s1c1
Sequence:CCGGCCCAACATCATCCCTGTTCTTCTCGAGAAGAACAGGGATGATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-1231s1c1
Sequence:CCGGGCGTCTTCCTATTCAGGATATCTCGAGATATCCTGAATAGGAAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-2232s1c1
Sequence:CCGGCCTCTGTTATTATTGAGGAAACTCGAGTTTCCTCAATAATAACAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-149s1c1
Sequence:CCGGGCAACAAATTATGAGACCCAACTCGAGTTGGGTCTCATAATTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-2528s1c1
Sequence:CCGGGTTGAAACTATACCCATGAAACTCGAGTTTCATGGGTATAGTTTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006017
PROM1 MISSION shRNA shRNA Plasmid DNA
prominin 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006017.2-1231s21c1
Sequence:CCGGCAGAACTTGACAACGTTAATACTCGAGTATTAACGTTGTCAAGTTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006017.2-404s21c1
Sequence:CCGGTGTGGTACAGCCGCGTGATTTCTCGAGAAATCACGCGGCTGTACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006017.2-3236s21c1
Sequence:CCGGGTGTACAGTAAACGGTGTATACTCGAGTATACACCGTTTACTGTACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-776s1c1
Sequence:CCGGCCCAACATCATCCCTGTTCTTCTCGAGAAGAACAGGGATGATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-1231s1c1
Sequence:CCGGGCGTCTTCCTATTCAGGATATCTCGAGATATCCTGAATAGGAAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-2232s1c1
Sequence:CCGGCCTCTGTTATTATTGAGGAAACTCGAGTTTCCTCAATAATAACAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-149s1c1
Sequence:CCGGGCAACAAATTATGAGACCCAACTCGAGTTGGGTCTCATAATTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-2528s1c1
Sequence:CCGGGTTGAAACTATACCCATGAAACTCGAGTTTCATGGGTATAGTTTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006017
PROM1 MISSION shRNA Lentiviral Transduction Particles
prominin 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006017.2-1231s21c1
Sequence:CCGGCAGAACTTGACAACGTTAATACTCGAGTATTAACGTTGTCAAGTTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416340    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006017.2-404s21c1
Sequence:CCGGTGTGGTACAGCCGCGTGATTTCTCGAGAAATCACGCGGCTGTACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006017.2-3236s21c1
Sequence:CCGGGTGTACAGTAAACGGTGTATACTCGAGTATACACCGTTTACTGTACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-776s1c1
Sequence:CCGGCCCAACATCATCCCTGTTCTTCTCGAGAAGAACAGGGATGATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-1231s1c1
Sequence:CCGGGCGTCTTCCTATTCAGGATATCTCGAGATATCCTGAATAGGAAGACGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-2232s1c1
Sequence:CCGGCCTCTGTTATTATTGAGGAAACTCGAGTTTCCTCAATAATAACAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-149s1c1
Sequence:CCGGGCAACAAATTATGAGACCCAACTCGAGTTGGGTCTCATAATTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006017.1-2528s1c1
Sequence:CCGGGTTGAAACTATACCCATGAAACTCGAGTTTCATGGGTATAGTTTCAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008935
PROM1 MISSION shRNA Bacterial Glycerol Stock
prominin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-2534s1c1
Sequence:CCGGCCCTCTGAATTTGTTCTGGTTCTCGAGAACCAGAACAAATTCAGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-1442s1c1
Sequence:CCGGGCTGGAAGAATATGACTCGTACTCGAGTACGAGTCATATTCTTCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-1800s1c1
Sequence:CCGGCTATTCAATAACCCAGACATTCTCGAGAATGTCTGGGTTATTGAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-880s1c1
Sequence:CCGGGCAGAATAAAGGACCAACTAACTCGAGTTAGTTGGTCCTTTATTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008935.1-3396s1c1
Sequence:CCGGCCTGCGGTTTAGAAATAGAATCTCGAGATTCTATTTCTAAACCGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008935
PROM1 MISSION shRNA shRNA Plasmid DNA
prominin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-2534s1c1
Sequence:CCGGCCCTCTGAATTTGTTCTGGTTCTCGAGAACCAGAACAAATTCAGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-1442s1c1
Sequence:CCGGGCTGGAAGAATATGACTCGTACTCGAGTACGAGTCATATTCTTCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-1800s1c1
Sequence:CCGGCTATTCAATAACCCAGACATTCTCGAGAATGTCTGGGTTATTGAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-880s1c1
Sequence:CCGGGCAGAATAAAGGACCAACTAACTCGAGTTAGTTGGTCCTTTATTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000115316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008935.1-3396s1c1
Sequence:CCGGCCTGCGGTTTAGAAATAGAATCTCGAGATTCTATTTCTAAACCGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008935
PROM1 MISSION shRNA Lentiviral Transduction Particles
prominin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-2534s1c1
Sequence:CCGGCCCTCTGAATTTGTTCTGGTTCTCGAGAACCAGAACAAATTCAGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-1442s1c1
Sequence:CCGGGCTGGAAGAATATGACTCGTACTCGAGTACGAGTCATATTCTTCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-1800s1c1
Sequence:CCGGCTATTCAATAACCCAGACATTCTCGAGAATGTCTGGGTTATTGAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008935.1-880s1c1
Sequence:CCGGGCAGAATAAAGGACCAACTAACTCGAGTTAGTTGGTCCTTTATTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000115316    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008935.1-3396s1c1
Sequence:CCGGCCTGCGGTTTAGAAATAGAATCTCGAGATTCTATTTCTAAACCGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)