EMAIL THIS PAGE TO A FRIEND

PROSC

proline synthetase co-transcribed homolog (bacterial)

105 Gene Product Result for
UniProtKB ID: O94903, Q6FI94
Gene ID:
Mouse(114863) proline synthetase co-transcribed
Rat(306544) proline synthetase co-transcribed homolog (bacterial)
Zebrafish(563548) proline synthetase co-transcribed homolog (bacterial)
dog(482854) proline synthetase co-transcribed homolog (bacterial)
domestic cat(101089098) proline synthetase co-transcribed homolog (bacterial)
chicken(426770) proline synthetase co-transcribed homolog (bacterial)
cow(509643) proline synthetase co-transcribed homolog (bacterial)
sheep(101117730) proline synthetase co-transcribed homolog (bacterial)
naked mole-rat(101713858) proline synthetase co-transcribed homolog (bacterial)
domestic guinea pig(100734311) proline synthetase co-transcribed homolog (bacterial)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007198 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007198 Rosetta Predictions human pricing
NM_001107320 Rosetta Predictions rat pricing
XM_224947 Rosetta Predictions rat pricing
NM_001039077 Rosetta Predictions mouse pricing
NM_001039078 Rosetta Predictions mouse pricing
NM_054057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042562 predicted 914
2 SASI_Hs01_00042563 predicted 1220
3 SASI_Hs01_00042564 predicted 1331
4 SASI_Hs01_00042565 predicted 1351
5 SASI_Hs01_00042566 predicted 1549
6 SASI_Hs02_00343177 predicted 747
7 SASI_Hs01_00042567 predicted 1085
8 SASI_Hs01_00042568 predicted 763
9 SASI_Hs01_00042569 predicted 905
10 SASI_Hs01_00042570 predicted 1182
11 SASI_Hs01_00042571 predicted 1564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107320 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227675 predicted 919
2 SASI_Rn02_00227676 predicted 716
3 SASI_Rn02_00227677 predicted 386
4 SASI_Rn02_00227678 predicted 799
5 SASI_Rn02_00227679 predicted 441
6 SASI_Rn02_00227680 predicted 637
7 SASI_Rn02_00227681 predicted 783
8 SASI_Rn02_00227682 predicted 620
9 SASI_Rn02_00227683 predicted 773
10 SASI_Rn02_00227684 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129285 predicted 203
2 SASI_Rn01_00129286 predicted 689
3 SASI_Rn01_00129287 predicted 1006
4 SASI_Rn01_00129288 predicted 777
5 SASI_Rn01_00129289 predicted 257
6 SASI_Rn01_00129290 predicted 959
7 SASI_Rn01_00129291 predicted 862
8 SASI_Rn01_00129292 predicted 551
9 SASI_Rn01_00129293 predicted 1133
10 SASI_Rn01_00129294 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022635 predicted 511
2 SASI_Mm01_00022637 predicted 564
3 SASI_Mm02_00289760 predicted 566
4 SASI_Mm01_00022639 predicted 785
5 SASI_Mm01_00022640 predicted 657
6 SASI_Mm01_00022641 predicted 260
7 SASI_Mm01_00022642 predicted 903
8 SASI_Mm01_00022643 predicted 650
9 SASI_Mm01_00022644 predicted 757
10 SASI_Mm02_00289761 predicted 649
11 SASI_Mm01_00022636 predicted 760
12 SASI_Mm01_00022638 predicted 717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120817 predicted 478
2 SASI_Mm01_00120819 predicted 529
3 SASI_Mm02_00289762 predicted 533
4 SASI_Mm01_00120821 predicted 745
5 SASI_Mm01_00120822 predicted 619
6 SASI_Mm01_00120823 predicted 868
7 SASI_Mm01_00120824 predicted 617
8 SASI_Mm01_00120825 predicted 716
9 SASI_Mm02_00289763 predicted 614
10 SASI_Mm02_00289764 predicted 937
11 SASI_Mm01_00120818 predicted 728
12 SASI_Mm01_00120820 predicted 683
13 SASI_Mm01_00120826 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00136770 predicted 254
2 SASI_Mm02_00337983 predicted 293
3 SASI_Mm02_00337984 predicted 254
4 SASI_Mm02_00337985 predicted 263
5 SASI_Mm02_00337986 predicted 285
6 SASI_Mm02_00337987 predicted 284
7 SASI_Mm02_00337988 predicted 203
8 SASI_Mm02_00337989 predicted 287
9 SASI_Mm02_00337990 predicted 257
10 SASI_Mm02_00337991 predicted 283
11 SASI_Mm01_00136771 predicted 1228
12 SASI_Mm01_00136772 predicted 790
13 SASI_Mm01_00136773 predicted 926
14 SASI_Mm01_00136774 predicted 1296
15 SASI_Mm01_00136775 predicted 1184
16 SASI_Mm01_00136776 predicted 501
17 SASI_Mm01_00136777 predicted 644
18 SASI_Mm01_00136778 predicted 1253
19 SASI_Mm01_00136779 predicted 1039
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054057
VALIDATED
PROSC MISSION shRNA Bacterial Glycerol Stock
proline synthetase co-transcribed homolog (bacterial)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000349516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-330s21c1
Sequence:CCGGGTGGCACTTCATTGGTCATTTCTCGAGAAATGACCAATGAAGTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-321s21c1
Sequence:CCGGCGAGATCAAGTGGCACTTCATCTCGAGATGAAGTGCCACTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-293s21c1
Sequence:CCGGCAAACCCTAAGATTCTGTCTTCTCGAGAAGACAGAATCTTAGGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-494s1c1
Sequence:CCGGTGGAACACATAAAGGCCAGTTCTCGAGAACTGGCCTTTATGTGTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-261s1c1
Sequence:CCGGCGAGATCAAGTGGCACTTCATCTCGAGATGAAGTGCCACTTGATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-233s1c1
Sequence:CCGGCAAACCCTAAGATTCTGTCTTCTCGAGAAGACAGAATCTTAGGGTTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-270s1c1
Sequence:CCGGGTGGCACTTCATTGGTCATTTCTCGAGAAATGACCAATGAAGTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-378s1c1
Sequence:CCGGGAATAGCTCCTGGCAGAAGAACTCGAGTTCTTCTGCCAGGAGCTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-438s21c1
Sequence:CCGGGAATAGCTCCTGGCAGAAGAACTCGAGTTCTTCTGCCAGGAGCTATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054057
VALIDATED
PROSC MISSION shRNA shRNA Plasmid DNA
proline synthetase co-transcribed homolog (bacterial)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000349516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-330s21c1
Sequence:CCGGGTGGCACTTCATTGGTCATTTCTCGAGAAATGACCAATGAAGTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-321s21c1
Sequence:CCGGCGAGATCAAGTGGCACTTCATCTCGAGATGAAGTGCCACTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-293s21c1
Sequence:CCGGCAAACCCTAAGATTCTGTCTTCTCGAGAAGACAGAATCTTAGGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-494s1c1
Sequence:CCGGTGGAACACATAAAGGCCAGTTCTCGAGAACTGGCCTTTATGTGTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-261s1c1
Sequence:CCGGCGAGATCAAGTGGCACTTCATCTCGAGATGAAGTGCCACTTGATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-233s1c1
Sequence:CCGGCAAACCCTAAGATTCTGTCTTCTCGAGAAGACAGAATCTTAGGGTTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-270s1c1
Sequence:CCGGGTGGCACTTCATTGGTCATTTCTCGAGAAATGACCAATGAAGTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-378s1c1
Sequence:CCGGGAATAGCTCCTGGCAGAAGAACTCGAGTTCTTCTGCCAGGAGCTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-438s21c1
Sequence:CCGGGAATAGCTCCTGGCAGAAGAACTCGAGTTCTTCTGCCAGGAGCTATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054057
VALIDATED
PROSC MISSION shRNA Lentiviral Transduction Particles
proline synthetase co-transcribed homolog (bacterial)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000349516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-330s21c1
Sequence:CCGGGTGGCACTTCATTGGTCATTTCTCGAGAAATGACCAATGAAGTGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-321s21c1
Sequence:CCGGCGAGATCAAGTGGCACTTCATCTCGAGATGAAGTGCCACTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-293s21c1
Sequence:CCGGCAAACCCTAAGATTCTGTCTTCTCGAGAAGACAGAATCTTAGGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-494s1c1
Sequence:CCGGTGGAACACATAAAGGCCAGTTCTCGAGAACTGGCCTTTATGTGTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-261s1c1
Sequence:CCGGCGAGATCAAGTGGCACTTCATCTCGAGATGAAGTGCCACTTGATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-233s1c1
Sequence:CCGGCAAACCCTAAGATTCTGTCTTCTCGAGAAGACAGAATCTTAGGGTTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-270s1c1
Sequence:CCGGGTGGCACTTCATTGGTCATTTCTCGAGAAATGACCAATGAAGTGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054057.1-378s1c1
Sequence:CCGGGAATAGCTCCTGGCAGAAGAACTCGAGTTCTTCTGCCAGGAGCTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054057.4-438s21c1
Sequence:CCGGGAATAGCTCCTGGCAGAAGAACTCGAGTTCTTCTGCCAGGAGCTATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007198
VALIDATED
PROSC MISSION shRNA Bacterial Glycerol Stock
proline synthetase co-transcribed homolog (bacterial)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007198.3-339s21c1
Sequence:CCGGGAGATCAAATGGCACTTCATTCTCGAGAATGAAGTGCCATTTGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007198.3-525s21c1
Sequence:CCGGGAAGAGAGTAAACATGGCCTTCTCGAGAAGGCCATGTTTACTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-1198s1c1
Sequence:CCGGCGGTTGAAGTAGGATCTACAACTCGAGTTGTAGATCCTACTTCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-709s1c1
Sequence:CCGGACGTTCAGGAACTGCTAGAAACTCGAGTTTCTAGCAGTTCCTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-765s1c1
Sequence:CCGGGAGATCAAATGGCACTTCATTCTCGAGAATGAAGTGCCATTTGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-951s1c1
Sequence:CCGGGAAGAGAGTAAACATGGCCTTCTCGAGAAGGCCATGTTTACTCTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007198.2-917s1c1
Sequence:CCGGGTTAAAGGTTATGGTCCAGATCTCGAGATCTGGACCATAACCTTTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007198.3-772s21c1
Sequence:CCGGCGGTTGAAGTAGGATCTACAACTCGAGTTGTAGATCCTACTTCAACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007198.3-796s21c1
Sequence:CCGGTCCGAATAGGAAGCACGATTTCTCGAGAAATCGTGCTTCCTATTCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007198.3-1314s21c1
Sequence:CCGGCTCCTACTACGTCGTCTAAATCTCGAGATTTAGACGACGTAGTAGGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007198
VALIDATED
PROSC MISSION shRNA shRNA Plasmid DNA
proline synthetase co-transcribed homolog (bacterial)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007198.3-339s21c1
Sequence:CCGGGAGATCAAATGGCACTTCATTCTCGAGAATGAAGTGCCATTTGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007198.3-525s21c1
Sequence:CCGGGAAGAGAGTAAACATGGCCTTCTCGAGAAGGCCATGTTTACTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-1198s1c1
Sequence:CCGGCGGTTGAAGTAGGATCTACAACTCGAGTTGTAGATCCTACTTCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-709s1c1
Sequence:CCGGACGTTCAGGAACTGCTAGAAACTCGAGTTTCTAGCAGTTCCTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-765s1c1
Sequence:CCGGGAGATCAAATGGCACTTCATTCTCGAGAATGAAGTGCCATTTGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-951s1c1
Sequence:CCGGGAAGAGAGTAAACATGGCCTTCTCGAGAAGGCCATGTTTACTCTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007198.2-917s1c1
Sequence:CCGGGTTAAAGGTTATGGTCCAGATCTCGAGATCTGGACCATAACCTTTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007198.3-772s21c1
Sequence:CCGGCGGTTGAAGTAGGATCTACAACTCGAGTTGTAGATCCTACTTCAACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007198.3-796s21c1
Sequence:CCGGTCCGAATAGGAAGCACGATTTCTCGAGAAATCGTGCTTCCTATTCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007198.3-1314s21c1
Sequence:CCGGCTCCTACTACGTCGTCTAAATCTCGAGATTTAGACGACGTAGTAGGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007198
VALIDATED
PROSC MISSION shRNA Lentiviral Transduction Particles
proline synthetase co-transcribed homolog (bacterial)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007198.3-339s21c1
Sequence:CCGGGAGATCAAATGGCACTTCATTCTCGAGAATGAAGTGCCATTTGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007198.3-525s21c1
Sequence:CCGGGAAGAGAGTAAACATGGCCTTCTCGAGAAGGCCATGTTTACTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-1198s1c1
Sequence:CCGGCGGTTGAAGTAGGATCTACAACTCGAGTTGTAGATCCTACTTCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-709s1c1
Sequence:CCGGACGTTCAGGAACTGCTAGAAACTCGAGTTTCTAGCAGTTCCTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-765s1c1
Sequence:CCGGGAGATCAAATGGCACTTCATTCTCGAGAATGAAGTGCCATTTGATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_007198.2-951s1c1
Sequence:CCGGGAAGAGAGTAAACATGGCCTTCTCGAGAAGGCCATGTTTACTCTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007198.2-917s1c1
Sequence:CCGGGTTAAAGGTTATGGTCCAGATCTCGAGATCTGGACCATAACCTTTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007198.3-772s21c1
Sequence:CCGGCGGTTGAAGTAGGATCTACAACTCGAGTTGTAGATCCTACTTCAACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_007198.3-796s21c1
Sequence:CCGGTCCGAATAGGAAGCACGATTTCTCGAGAAATCGTGCTTCCTATTCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_007198.3-1314s21c1
Sequence:CCGGCTCCTACTACGTCGTCTAAATCTCGAGATTTAGACGACGTAGTAGGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)