EMAIL THIS PAGE TO A FRIEND

PROSER1

proline and serine rich 1

116 Gene Product Result for
Synonyms: C13orf23
UniProtKB ID: Q86XN7, Q6P2S2, Q7Z3X5, Q8N3D2, Q8N3P1, Q9H9M1
Gene ID:
Human(80209) Summary: This gene encodes a conserved protein containing proline and serine rich regions. These regions may be important in protein-protein interactions. [provided by RefSeq, Aug 2012]
Mouse(212127) proline and serine rich 1
Rat(310417) proline and serine rich 1
domestic guinea pig(100728740) proline and serine rich 1
naked mole-rat(101714657) proline and serine rich 1
cow(525806) proline and serine rich 1
sheep(101108141) proline and serine rich 1
chicken(418891) proline and serine rich 1
domestic cat(101089569) proline and serine rich 1
dog(486000) proline and serine rich 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025138 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025138 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025138 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173382 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173382 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173382 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025138 Rosetta Predictions human pricing
NM_170719 Rosetta Predictions human pricing
NM_001107676 Rosetta Predictions rat pricing
NM_173382 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357861 predicted 1394
2 SASI_Hs02_00357862 predicted 1379
3 SASI_Hs01_00131725 predicted 3022
4 SASI_Hs01_00131728 predicted 1597
5 SASI_Hs02_00357863 predicted 1733
6 SASI_Hs01_00131729 predicted 2666
7 SASI_Hs01_00131731 predicted 1728
8 SASI_Hs02_00357864 predicted 2036
9 SASI_Hs01_00131732 predicted 2208
10 SASI_Hs01_00131733 predicted 2528
11 SASI_Hs01_00131726 predicted 2244
12 SASI_Hs01_00131727 predicted 1440
13 SASI_Hs01_00131730 predicted 1718
14 SASI_Hs01_00131734 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170719 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367672 predicted 1325
2 SASI_Hs02_00367673 predicted 1312
3 SASI_Hs01_00087698 predicted 2959
4 SASI_Hs01_00087701 predicted 1535
5 SASI_Hs02_00367674 predicted 1670
6 SASI_Hs01_00087702 predicted 2600
7 SASI_Hs01_00087704 predicted 1660
8 SASI_Hs02_00367675 predicted 1963
9 SASI_Hs01_00087705 predicted 2144
10 SASI_Hs01_00087706 predicted 2458
11 SASI_Hs01_00087699 predicted 2174
12 SASI_Hs01_00087700 predicted 1368
13 SASI_Hs01_00087703 predicted 1649
14 SASI_Hs01_00087707 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107676 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231175 predicted 2333
2 SASI_Rn02_00231176 predicted 3401
3 SASI_Rn02_00231177 predicted 906
4 SASI_Rn02_00231178 predicted 810
5 SASI_Rn02_00231179 predicted 1610
6 SASI_Rn02_00231180 predicted 688
7 SASI_Rn02_00231181 predicted 3423
8 SASI_Rn02_00231182 predicted 2028
9 SASI_Rn02_00231183 predicted 1255
10 SASI_Rn02_00231184 predicted 1212
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148665 predicted 730
2 SASI_Mm01_00148666 predicted 2202
3 SASI_Mm02_00345200 predicted 999
4 SASI_Mm01_00148667 predicted 3260
5 SASI_Mm01_00148668 predicted 673
6 SASI_Mm01_00148669 predicted 1191
7 SASI_Mm01_00148670 predicted 743
8 SASI_Mm01_00148671 predicted 3264
9 SASI_Mm01_00148672 predicted 957
10 SASI_Mm01_00148673 predicted 1900
11 SASI_Mm01_00148674 predicted 3229
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025138
VALIDATED
PROSER1 MISSION shRNA Bacterial Glycerol Stock
proline and serine rich 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025138.2-2725s1c1
Sequence:CCGGGCCGTGCATATACTTCAACATCTCGAGATGTTGAAGTATATGCACGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167271    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025138.2-4739s1c1
Sequence:CCGGCGGAAGATGTTGCTAATGTATCTCGAGATACATTAGCAACATCTTCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_025138.2-2877s1c1
Sequence:CCGGGCACCAGTATTCACTGCTCTTCTCGAGAAGAGCAGTGAATACTGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025138.2-1363s1c1
Sequence:CCGGCCAAACCACCTCCTTCAACATCTCGAGATGTTGAAGGAGGTGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025138.2-4400s1c1
Sequence:CCGGCCTCTGTTACTTACTGTACTACTCGAGTAGTACAGTAAGTAACAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_025138.2-3466s1c1
Sequence:CCGGCCTTGCAAGAATTACAGCATACTCGAGTATGCTGTAATTCTTGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025138.3-2303s21c1
Sequence:CCGGCATCCAATGACACCAATTTAACTCGAGTTAAATTGGTGTCATTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025138.3-3762s21c1
Sequence:CCGGGCAATGAACAATCTGACAAATCTCGAGATTTGTCAGATTGTTCATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025138.3-3420s21c1
Sequence:CCGGTGTTGCACAAGCCGGTTTATCCTCGAGGATAAACCGGCTTGTGCAACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025138.3-1321s21c1
Sequence:CCGGGGAAGACCTAGCCGCATAAATCTCGAGATTTATGCGGCTAGGTCTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025138
VALIDATED
PROSER1 MISSION shRNA shRNA Plasmid DNA
proline and serine rich 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025138.2-2725s1c1
Sequence:CCGGGCCGTGCATATACTTCAACATCTCGAGATGTTGAAGTATATGCACGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167271    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025138.2-4739s1c1
Sequence:CCGGCGGAAGATGTTGCTAATGTATCTCGAGATACATTAGCAACATCTTCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_025138.2-2877s1c1
Sequence:CCGGGCACCAGTATTCACTGCTCTTCTCGAGAAGAGCAGTGAATACTGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025138.2-1363s1c1
Sequence:CCGGCCAAACCACCTCCTTCAACATCTCGAGATGTTGAAGGAGGTGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025138.2-4400s1c1
Sequence:CCGGCCTCTGTTACTTACTGTACTACTCGAGTAGTACAGTAAGTAACAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_025138.2-3466s1c1
Sequence:CCGGCCTTGCAAGAATTACAGCATACTCGAGTATGCTGTAATTCTTGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025138.3-2303s21c1
Sequence:CCGGCATCCAATGACACCAATTTAACTCGAGTTAAATTGGTGTCATTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025138.3-3762s21c1
Sequence:CCGGGCAATGAACAATCTGACAAATCTCGAGATTTGTCAGATTGTTCATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025138.3-3420s21c1
Sequence:CCGGTGTTGCACAAGCCGGTTTATCCTCGAGGATAAACCGGCTTGTGCAACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025138.3-1321s21c1
Sequence:CCGGGGAAGACCTAGCCGCATAAATCTCGAGATTTATGCGGCTAGGTCTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025138
VALIDATED
PROSER1 MISSION shRNA Lentiviral Transduction Particles
proline and serine rich 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025138.2-2725s1c1
Sequence:CCGGGCCGTGCATATACTTCAACATCTCGAGATGTTGAAGTATATGCACGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167271    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025138.2-4739s1c1
Sequence:CCGGCGGAAGATGTTGCTAATGTATCTCGAGATACATTAGCAACATCTTCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137485    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_025138.2-2877s1c1
Sequence:CCGGGCACCAGTATTCACTGCTCTTCTCGAGAAGAGCAGTGAATACTGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_025138.2-1363s1c1
Sequence:CCGGCCAAACCACCTCCTTCAACATCTCGAGATGTTGAAGGAGGTGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134104    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025138.2-4400s1c1
Sequence:CCGGCCTCTGTTACTTACTGTACTACTCGAGTAGTACAGTAAGTAACAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_025138.2-3466s1c1
Sequence:CCGGCCTTGCAAGAATTACAGCATACTCGAGTATGCTGTAATTCTTGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025138.3-2303s21c1
Sequence:CCGGCATCCAATGACACCAATTTAACTCGAGTTAAATTGGTGTCATTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421440    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025138.3-3762s21c1
Sequence:CCGGGCAATGAACAATCTGACAAATCTCGAGATTTGTCAGATTGTTCATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420545    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025138.3-3420s21c1
Sequence:CCGGTGTTGCACAAGCCGGTTTATCCTCGAGGATAAACCGGCTTGTGCAACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025138.3-1321s21c1
Sequence:CCGGGGAAGACCTAGCCGCATAAATCTCGAGATTTATGCGGCTAGGTCTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173382
VALIDATED
PROSER1 MISSION shRNA Bacterial Glycerol Stock
proline and serine rich 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173382.1-3372s1c1
Sequence:CCGGCCCATGTAAATAAGATGACAACTCGAGTTGTCATCTTATTTACATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173382.1-3255s1c1
Sequence:CCGGGCAGTGAACAATCTGACAGATCTCGAGATCTGTCAGATTGTTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173382.1-864s1c1
Sequence:CCGGGATTTCTTCGTGTGGAACCTTCTCGAGAAGGTTCCACACGAAGAAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173382.1-1805s1c1
Sequence:CCGGCGGGTCCACATGGTGTAAATACTCGAGTATTTACACCATGTGGACCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173382.1-1805s21c1
Sequence:CCGGCGGGTCCACATGGTGTAAATACTCGAGTATTTACACCATGTGGACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173382.1-2488s21c1
Sequence:CCGGCCTTTCACTTCATTGACTAATCTCGAGATTAGTCAATGAAGTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173382.1-864s21c1
Sequence:CCGGGATTTCTTCGTGTGGAACCTTCTCGAGAAGGTTCCACACGAAGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173382.1-3255s21c1
Sequence:CCGGGCAGTGAACAATCTGACAGATCTCGAGATCTGTCAGATTGTTCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173382
VALIDATED
PROSER1 MISSION shRNA shRNA Plasmid DNA
proline and serine rich 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173382.1-3372s1c1
Sequence:CCGGCCCATGTAAATAAGATGACAACTCGAGTTGTCATCTTATTTACATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173382.1-3255s1c1
Sequence:CCGGGCAGTGAACAATCTGACAGATCTCGAGATCTGTCAGATTGTTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173382.1-864s1c1
Sequence:CCGGGATTTCTTCGTGTGGAACCTTCTCGAGAAGGTTCCACACGAAGAAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173382.1-1805s1c1
Sequence:CCGGCGGGTCCACATGGTGTAAATACTCGAGTATTTACACCATGTGGACCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173382.1-1805s21c1
Sequence:CCGGCGGGTCCACATGGTGTAAATACTCGAGTATTTACACCATGTGGACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173382.1-2488s21c1
Sequence:CCGGCCTTTCACTTCATTGACTAATCTCGAGATTAGTCAATGAAGTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173382.1-864s21c1
Sequence:CCGGGATTTCTTCGTGTGGAACCTTCTCGAGAAGGTTCCACACGAAGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173382.1-3255s21c1
Sequence:CCGGGCAGTGAACAATCTGACAGATCTCGAGATCTGTCAGATTGTTCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173382
VALIDATED
PROSER1 MISSION shRNA Lentiviral Transduction Particles
proline and serine rich 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183845    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_173382.1-3372s1c1
Sequence:CCGGCCCATGTAAATAAGATGACAACTCGAGTTGTCATCTTATTTACATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179283    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_173382.1-3255s1c1
Sequence:CCGGGCAGTGAACAATCTGACAGATCTCGAGATCTGTCAGATTGTTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173382.1-864s1c1
Sequence:CCGGGATTTCTTCGTGTGGAACCTTCTCGAGAAGGTTCCACACGAAGAAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173382.1-1805s1c1
Sequence:CCGGCGGGTCCACATGGTGTAAATACTCGAGTATTTACACCATGTGGACCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173382.1-1805s21c1
Sequence:CCGGCGGGTCCACATGGTGTAAATACTCGAGTATTTACACCATGTGGACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173382.1-2488s21c1
Sequence:CCGGCCTTTCACTTCATTGACTAATCTCGAGATTAGTCAATGAAGTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173382.1-864s21c1
Sequence:CCGGGATTTCTTCGTGTGGAACCTTCTCGAGAAGGTTCCACACGAAGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353356    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173382.1-3255s21c1
Sequence:CCGGGCAGTGAACAATCTGACAGATCTCGAGATCTGTCAGATTGTTCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)