EMAIL THIS PAGE TO A FRIEND

PROX1

prospero homeobox 1

91 Gene Product Result for
UniProtKB ID: Q92786, A6NK29, A8K2B1, Q5SW76, Q8TB91
Gene ID:
Human(5629) Summary: The protein encoded by this gene is a member of the homeobox transcription factor family. Members of this family contain a homeobox domain that consists of a 60-amino acid helix-turn-helix structure that binds DNA and RNA. The protein encoded by this gene is conserved across vertebrates and may play an essential role during development. Altered levels of this protein have been reported in cancers of different organs, such as colon, brain, blood, breast, pancreas, liver and esophagus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(19130) prospero-related homeobox 1
Rat(305066) prospero homeobox 1
chicken(395802) prospero homeobox 1
domestic cat(101097448) prospero homeobox 1
Horse(100050316) prospero homeobox 1
dog(490291) prospero homeobox 1
cow(515324) prospero homeobox 1
sheep(101112662) prospero homeobox 1
domestic guinea pig(100734650) prospero homeobox 1
naked mole-rat(101719154) prospero homeobox 1
Domestic Rabbit(100357251) prospero homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008937 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008937 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008937 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002763 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053851 MISSION® esiRNA esiRNA human PROX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002763 Rosetta Predictions human pricing
NM_001107201 Rosetta Predictions rat pricing
NM_008937 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184281 predicted 2002
2 SASI_Hs02_00334386 predicted 543
3 SASI_Hs01_00184283 predicted 296
4 SASI_Hs01_00184284 predicted 2077
5 SASI_Hs01_00184285 predicted 2048
6 SASI_Hs01_00184287 predicted 2213
7 SASI_Hs01_00184288 predicted 1970
8 SASI_Hs01_00184289 predicted 1948
9 SASI_Hs01_00184290 predicted 2129
10 SASI_Hs02_00334387 predicted 706
11 SASI_Hs01_00184282 predicted 2392
12 SASI_Hs01_00184286 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107201 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226505 predicted 847
2 SASI_Rn02_00226506 predicted 2291
3 SASI_Rn02_00226507 predicted 1949
4 SASI_Rn02_00226508 predicted 2285
5 SASI_Rn02_00226509 predicted 1357
6 SASI_Rn02_00226510 predicted 2327
7 SASI_Rn02_00226511 predicted 926
8 SASI_Rn02_00226512 predicted 1932
9 SASI_Rn02_00226513 predicted 798
10 SASI_Rn02_00226514 predicted 1486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008937 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191650 predicted 856
2 SASI_Mm01_00191651 predicted 2180
3 SASI_Mm01_00191652 predicted 1713
4 SASI_Mm01_00191653 predicted 2024
5 SASI_Mm01_00191654 predicted 2593
6 SASI_Mm01_00191655 predicted 1936
7 SASI_Mm01_00191656 predicted 850
8 SASI_Mm02_00314976 predicted 2492
9 SASI_Mm01_00191657 predicted 2181
10 SASI_Mm02_00314977 predicted 1492
11 SASI_Mm01_00191658 predicted 1581
12 SASI_Mm01_00191659 predicted 2296
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008937
PROX1 MISSION shRNA Bacterial Glycerol Stock
prospero homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-2573s1c1
Sequence:CCGGCGGGCAAAGATGTTGATCCTTCTCGAGAAGGATCAACATCTTTGCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-583s1c1
Sequence:CCGGGCTAAGGCAAGGGCAACATTTCTCGAGAAATGTTGCCCTTGCCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-2186s1c1
Sequence:CCGGCACCTTATTCAGGAAGCGCAACTCGAGTTGCGCTTCCTGAATAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-2303s1c1
Sequence:CCGGCGGACGTGAAGTTCAACAGATCTCGAGATCTGTTGAACTTCACGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-842s1c1
Sequence:CCGGCCGAAGTACATCAGGAGGATACTCGAGTATCCTCCTGATGTACTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008937.2-932s21c1
Sequence:CCGGAGTTTGATGTGGATCGCTTATCTCGAGATAAGCGATCCACATCAAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008937.2-1518s21c1
Sequence:CCGGGCATCTGGCAGAGACCTTAAACTCGAGTTTAAGGTCTCTGCCAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008937.2-2902s21c1
Sequence:CCGGTTTGCCCAAGGCCCTTAATATCTCGAGATATTAAGGGCCTTGGGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008937
PROX1 MISSION shRNA shRNA Plasmid DNA
prospero homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-2573s1c1
Sequence:CCGGCGGGCAAAGATGTTGATCCTTCTCGAGAAGGATCAACATCTTTGCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-583s1c1
Sequence:CCGGGCTAAGGCAAGGGCAACATTTCTCGAGAAATGTTGCCCTTGCCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-2186s1c1
Sequence:CCGGCACCTTATTCAGGAAGCGCAACTCGAGTTGCGCTTCCTGAATAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-2303s1c1
Sequence:CCGGCGGACGTGAAGTTCAACAGATCTCGAGATCTGTTGAACTTCACGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-842s1c1
Sequence:CCGGCCGAAGTACATCAGGAGGATACTCGAGTATCCTCCTGATGTACTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008937.2-932s21c1
Sequence:CCGGAGTTTGATGTGGATCGCTTATCTCGAGATAAGCGATCCACATCAAACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008937.2-1518s21c1
Sequence:CCGGGCATCTGGCAGAGACCTTAAACTCGAGTTTAAGGTCTCTGCCAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008937.2-2902s21c1
Sequence:CCGGTTTGCCCAAGGCCCTTAATATCTCGAGATATTAAGGGCCTTGGGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008937
PROX1 MISSION shRNA Lentiviral Transduction Particles
prospero homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-2573s1c1
Sequence:CCGGCGGGCAAAGATGTTGATCCTTCTCGAGAAGGATCAACATCTTTGCCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-583s1c1
Sequence:CCGGGCTAAGGCAAGGGCAACATTTCTCGAGAAATGTTGCCCTTGCCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-2186s1c1
Sequence:CCGGCACCTTATTCAGGAAGCGCAACTCGAGTTGCGCTTCCTGAATAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-2303s1c1
Sequence:CCGGCGGACGTGAAGTTCAACAGATCTCGAGATCTGTTGAACTTCACGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008937.2-842s1c1
Sequence:CCGGCCGAAGTACATCAGGAGGATACTCGAGTATCCTCCTGATGTACTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008937.2-932s21c1
Sequence:CCGGAGTTTGATGTGGATCGCTTATCTCGAGATAAGCGATCCACATCAAACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008937.2-1518s21c1
Sequence:CCGGGCATCTGGCAGAGACCTTAAACTCGAGTTTAAGGTCTCTGCCAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420735    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008937.2-2902s21c1
Sequence:CCGGTTTGCCCAAGGCCCTTAATATCTCGAGATATTAAGGGCCTTGGGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002763
VALIDATED
PROX1 MISSION shRNA Bacterial Glycerol Stock
prospero homeobox 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002763.3-2713s1c1
Sequence:CCGGCCCTTAACATTTGGACACTTACTCGAGTAAGTGTCCAAATGTTAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-2095s1c1
Sequence:CCGGCCGACGTAAAGTTCAACAGATCTCGAGATCTGTTGAACTTTACGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-722s1c1
Sequence:CCGGCCAGTTTGATATGGATCGCTTCTCGAGAAGCGATCCATATCAAACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-2262s1c1
Sequence:CCGGGCTCTGAACATGCACTACAATCTCGAGATTGTAGTGCATGTTCAGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-871s1c1
Sequence:CCGGCCCGAGAAAGTTACAGAGAAACTCGAGTTTCTCTGTAACTTTCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002763.3-531s21c1
Sequence:CCGGTTTCCAGGAGCAACCATAATTCTCGAGAATTATGGTTGCTCCTGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002763.3-1918s21c1
Sequence:CCGGGGCTCTCCTTGTCGCTCATAACTCGAGTTATGAGCGACAAGGAGAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002763.3-2529s21c1
Sequence:CCGGCCCTTTGGATGTCCAAGTTATCTCGAGATAACTTGGACATCCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002763.3-2319s21c1
Sequence:CCGGGAAGTTGCTCAGATCACATTACTCGAGTAATGTGATCTGAGCAACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002763.3-638s21c1
Sequence:CCGGAGTACATCAGGAGGATATATGCTCGAGCATATATCCTCCTGATGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002763
VALIDATED
PROX1 MISSION shRNA shRNA Plasmid DNA
prospero homeobox 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002763.3-2713s1c1
Sequence:CCGGCCCTTAACATTTGGACACTTACTCGAGTAAGTGTCCAAATGTTAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-2095s1c1
Sequence:CCGGCCGACGTAAAGTTCAACAGATCTCGAGATCTGTTGAACTTTACGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-722s1c1
Sequence:CCGGCCAGTTTGATATGGATCGCTTCTCGAGAAGCGATCCATATCAAACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-2262s1c1
Sequence:CCGGGCTCTGAACATGCACTACAATCTCGAGATTGTAGTGCATGTTCAGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-871s1c1
Sequence:CCGGCCCGAGAAAGTTACAGAGAAACTCGAGTTTCTCTGTAACTTTCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002763.3-531s21c1
Sequence:CCGGTTTCCAGGAGCAACCATAATTCTCGAGAATTATGGTTGCTCCTGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002763.3-1918s21c1
Sequence:CCGGGGCTCTCCTTGTCGCTCATAACTCGAGTTATGAGCGACAAGGAGAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002763.3-2529s21c1
Sequence:CCGGCCCTTTGGATGTCCAAGTTATCTCGAGATAACTTGGACATCCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002763.3-2319s21c1
Sequence:CCGGGAAGTTGCTCAGATCACATTACTCGAGTAATGTGATCTGAGCAACTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002763.3-638s21c1
Sequence:CCGGAGTACATCAGGAGGATATATGCTCGAGCATATATCCTCCTGATGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002763
VALIDATED
PROX1 MISSION shRNA Lentiviral Transduction Particles
prospero homeobox 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016248    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002763.3-2713s1c1
Sequence:CCGGCCCTTAACATTTGGACACTTACTCGAGTAAGTGTCCAAATGTTAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016251    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-2095s1c1
Sequence:CCGGCCGACGTAAAGTTCAACAGATCTCGAGATCTGTTGAACTTTACGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-722s1c1
Sequence:CCGGCCAGTTTGATATGGATCGCTTCTCGAGAAGCGATCCATATCAAACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016250    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-2262s1c1
Sequence:CCGGGCTCTGAACATGCACTACAATCTCGAGATTGTAGTGCATGTTCAGAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002763.3-871s1c1
Sequence:CCGGCCCGAGAAAGTTACAGAGAAACTCGAGTTTCTCTGTAACTTTCTCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002763.3-531s21c1
Sequence:CCGGTTTCCAGGAGCAACCATAATTCTCGAGAATTATGGTTGCTCCTGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_002763.3-1918s21c1
Sequence:CCGGGGCTCTCCTTGTCGCTCATAACTCGAGTTATGAGCGACAAGGAGAGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002763.3-2529s21c1
Sequence:CCGGCCCTTTGGATGTCCAAGTTATCTCGAGATAACTTGGACATCCAAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002763.3-2319s21c1
Sequence:CCGGGAAGTTGCTCAGATCACATTACTCGAGTAATGTGATCTGAGCAACTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002763.3-638s21c1
Sequence:CCGGAGTACATCAGGAGGATATATGCTCGAGCATATATCCTCCTGATGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)