EMAIL THIS PAGE TO A FRIEND

PROX2

prospero homeobox 2

52 Gene Product Result for
Synonyms: PROX-2
UniProtKB ID: Q3B8N5, C9J5W1, Q8N9Q3
Gene ID:
Mouse(73422) prospero homeobox 2
Rat(314319) prospero homeobox 2
Zebrafish(100003863) prospero homeobox 2
chicken(101665621) prospero homeobox 2
chicken(101749071) prospero homeobox 2
domestic cat(101083521) prospero homeobox 2
Horse(100051277) prospero homeobox 2
dog(490786) prospero homeobox 2
naked mole-rat(101697169) prospero homeobox 2
domestic guinea pig(100723655) prospero homeobox 2
cow(529720) prospero homeobox 2
sheep(101108394) prospero homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080408 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080408 Rosetta Predictions human pricing
XM_001057168 Rosetta Predictions rat pricing
XM_234418 Rosetta Predictions rat pricing
NM_175198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00314558 predicted 1038
2 SASI_Hs02_00314559 predicted 1404
3 SASI_Hs02_00314560 predicted 663
4 SASI_Hs02_00314561 predicted 830
5 SASI_Hs02_00314562 predicted 1529
6 SASI_Hs02_00314563 predicted 1307
7 SASI_Hs02_00314564 predicted 998
8 SASI_Hs02_00314565 predicted 1325
9 SASI_Hs02_00314566 predicted 1133
10 SASI_Hs02_00314567 predicted 1147
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285646 predicted 1316
2 SASI_Rn02_00285647 predicted 1419
3 SASI_Rn02_00285648 predicted 1486
4 SASI_Rn02_00285649 predicted 584
5 SASI_Rn02_00285650 predicted 409
6 SASI_Rn02_00285651 predicted 1426
7 SASI_Rn02_00285652 predicted 549
8 SASI_Rn02_00285653 predicted 379
9 SASI_Rn02_00285654 predicted 989
10 SASI_Rn02_00285655 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234418 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388479 predicted 1316
2 SASI_Rn02_00388480 predicted 1416
3 SASI_Rn02_00388481 predicted 1494
4 SASI_Rn02_00388482 predicted 583
5 SASI_Rn02_00388483 predicted 408
6 SASI_Rn02_00388484 predicted 1423
7 SASI_Rn02_00388485 predicted 549
8 SASI_Rn02_00388486 predicted 380
9 SASI_Rn02_00388487 predicted 993
10 SASI_Rn02_00388488 predicted 1391
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199895 predicted 1067
2 SASI_Mm01_00199896 predicted 1659
3 SASI_Mm01_00199897 predicted 1925
4 SASI_Mm01_00199898 predicted 739
5 SASI_Mm01_00199899 predicted 1894
6 SASI_Mm01_00199900 predicted 1719
7 SASI_Mm01_00199901 predicted 2115
8 SASI_Mm02_00345862 predicted 1709
9 SASI_Mm01_00199902 predicted 2103
10 SASI_Mm01_00199903 predicted 531
11 SASI_Mm01_00199904 predicted 1750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175198
PROX2 MISSION shRNA Bacterial Glycerol Stock
prospero homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175198.4-2400s21c1
Sequence:CCGGACCACAGTCCATCAGCTAAATCTCGAGATTTAGCTGATGGACTGTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175198.4-2278s21c1
Sequence:CCGGTTTGTCATAAATGGCAGTTTACTCGAGTAAACTGCCATTTATGACAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175198.4-1783s21c1
Sequence:CCGGTTCAGCAACTTCCGTGAATTTCTCGAGAAATTCACGGAAGTTGCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175198.2-2500s1c1
Sequence:CCGGGCAGTGATAATTTCCTGGTATCTCGAGATACCAGGAAATTATCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-2035s1c1
Sequence:CCGGGAAACCCATTTACAAGGTTATCTCGAGATAACCTTGTAAATGGGTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-1076s1c1
Sequence:CCGGTCCGTATTACAGCAAGTGCTACTCGAGTAGCACTTGCTGTAATACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-1900s1c1
Sequence:CCGGCCGAGTTCTCAATACACACTACTCGAGTAGTGTGTATTGAGAACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-1077s1c1
Sequence:CCGGCCGTATTACAGCAAGTGCTATCTCGAGATAGCACTTGCTGTAATACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175198
PROX2 MISSION shRNA shRNA Plasmid DNA
prospero homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175198.4-2400s21c1
Sequence:CCGGACCACAGTCCATCAGCTAAATCTCGAGATTTAGCTGATGGACTGTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175198.4-2278s21c1
Sequence:CCGGTTTGTCATAAATGGCAGTTTACTCGAGTAAACTGCCATTTATGACAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175198.4-1783s21c1
Sequence:CCGGTTCAGCAACTTCCGTGAATTTCTCGAGAAATTCACGGAAGTTGCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175198.2-2500s1c1
Sequence:CCGGGCAGTGATAATTTCCTGGTATCTCGAGATACCAGGAAATTATCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-2035s1c1
Sequence:CCGGGAAACCCATTTACAAGGTTATCTCGAGATAACCTTGTAAATGGGTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-1076s1c1
Sequence:CCGGTCCGTATTACAGCAAGTGCTACTCGAGTAGCACTTGCTGTAATACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-1900s1c1
Sequence:CCGGCCGAGTTCTCAATACACACTACTCGAGTAGTGTGTATTGAGAACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000084694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-1077s1c1
Sequence:CCGGCCGTATTACAGCAAGTGCTATCTCGAGATAGCACTTGCTGTAATACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175198
PROX2 MISSION shRNA Lentiviral Transduction Particles
prospero homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434934    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175198.4-2400s21c1
Sequence:CCGGACCACAGTCCATCAGCTAAATCTCGAGATTTAGCTGATGGACTGTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426592    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175198.4-2278s21c1
Sequence:CCGGTTTGTCATAAATGGCAGTTTACTCGAGTAAACTGCCATTTATGACAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175198.4-1783s21c1
Sequence:CCGGTTCAGCAACTTCCGTGAATTTCTCGAGAAATTCACGGAAGTTGCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084693    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175198.2-2500s1c1
Sequence:CCGGGCAGTGATAATTTCCTGGTATCTCGAGATACCAGGAAATTATCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084696    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-2035s1c1
Sequence:CCGGGAAACCCATTTACAAGGTTATCTCGAGATAACCTTGTAAATGGGTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-1076s1c1
Sequence:CCGGTCCGTATTACAGCAAGTGCTACTCGAGTAGCACTTGCTGTAATACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-1900s1c1
Sequence:CCGGCCGAGTTCTCAATACACACTACTCGAGTAGTGTGTATTGAGAACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000084694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175198.2-1077s1c1
Sequence:CCGGCCGTATTACAGCAAGTGCTATCTCGAGATAGCACTTGCTGTAATACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080408
PROX2 MISSION shRNA Bacterial Glycerol Stock
prospero homeobox 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000218444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1332s21c1
Sequence:GTACCGGCTTGAAGAAGGCCAAACTAATCTCGAGATTAGTTTGGCCTTCTTCAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1409s21c1
Sequence:CCGGTTCAGTTCAACCGCTGCATTACTCGAGTAATGCAGCGGTTGAACTGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1302s21c1
Sequence:CCGGGCATATCCAGGAGGGTCTAAACTCGAGTTTAGACCCTCCTGGATATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1138s21c1
Sequence:CCGGCGACCTTGGAGAACTACTAAGCTCGAGCTTAGTAGTTCTCCAAGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-706s21c1
Sequence:CCGGCAGGCTGTGGACTCGGTATTACTCGAGTAATACCGAGTCCACAGCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080408
PROX2 MISSION shRNA shRNA Plasmid DNA
prospero homeobox 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000218444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1332s21c1
Sequence:GTACCGGCTTGAAGAAGGCCAAACTAATCTCGAGATTAGTTTGGCCTTCTTCAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1409s21c1
Sequence:CCGGTTCAGTTCAACCGCTGCATTACTCGAGTAATGCAGCGGTTGAACTGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1302s21c1
Sequence:CCGGGCATATCCAGGAGGGTCTAAACTCGAGTTTAGACCCTCCTGGATATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1138s21c1
Sequence:CCGGCGACCTTGGAGAACTACTAAGCTCGAGCTTAGTAGTTCTCCAAGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000230676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-706s21c1
Sequence:CCGGCAGGCTGTGGACTCGGTATTACTCGAGTAATACCGAGTCCACAGCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080408
PROX2 MISSION shRNA Lentiviral Transduction Particles
prospero homeobox 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000218444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1332s21c1
Sequence:GTACCGGCTTGAAGAAGGCCAAACTAATCTCGAGATTAGTTTGGCCTTCTTCAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1409s21c1
Sequence:CCGGTTCAGTTCAACCGCTGCATTACTCGAGTAATGCAGCGGTTGAACTGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1302s21c1
Sequence:CCGGGCATATCCAGGAGGGTCTAAACTCGAGTTTAGACCCTCCTGGATATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-1138s21c1
Sequence:CCGGCGACCTTGGAGAACTACTAAGCTCGAGCTTAGTAGTTCTCCAAGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000230676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080408.1-706s21c1
Sequence:CCGGCAGGCTGTGGACTCGGTATTACTCGAGTAATACCGAGTCCACAGCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)