EMAIL THIS PAGE TO A FRIEND

PROZ

protein Z, vitamin K-dependent plasma glycoprotein

52 Gene Product Result for
Synonyms: PZ
UniProtKB ID: P22891, A6NMB4, Q15213, Q5JVF5, Q5JVF6
Gene ID:
Human(8858) Summary: This gene encodes a liver vitamin K-dependent glycoprotein that is synthesized in the liver and secreted into the plasma. The encoded protein plays a role in regulating blood coagulation by complexing with protein Z-dependent protease inhibitor to directly inhibit activated factor X at the phospholipid surface. Deficiencies in this protein are associated with an increased risk of ischemic arterial diseases and fetal loss. Mutations in this gene are the cause of protein Z deficiency. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Mouse(66901) protein Z, vitamin K-dependent plasma glycoprotein
Rat(306608) protein Z, vitamin K-dependent plasma glycoprotein
cow(617946) protein Z, vitamin K-dependent plasma glycoprotein
domestic guinea pig(100714435) protein Z, vitamin K-dependent plasma glycoprotein
naked mole-rat(101704499) protein Z, vitamin K-dependent plasma glycoprotein
chicken(418746) protein Z, vitamin K-dependent plasma glycoprotein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025834 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025834 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025834 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003891 Rosetta Predictions human pricing
NM_001107325 Rosetta Predictions rat pricing
NM_025834 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069492 predicted 1179
2 SASI_Hs01_00069493 predicted 1193
3 SASI_Hs01_00069494 predicted 240
4 SASI_Hs01_00069495 predicted 673
5 SASI_Hs01_00069496 predicted 662
6 SASI_Hs01_00069497 predicted 360
7 SASI_Hs01_00069498 predicted 1000
8 SASI_Hs02_00336506 predicted 568
9 SASI_Hs01_00069500 predicted 1216
10 SASI_Hs01_00069501 predicted 612
11 SASI_Hs01_00069499 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107325 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227725 predicted 616
2 SASI_Rn02_00227726 predicted 411
3 SASI_Rn02_00227727 predicted 610
4 SASI_Rn02_00227728 predicted 476
5 SASI_Rn02_00227729 predicted 234
6 SASI_Rn02_00227730 predicted 361
7 SASI_Rn02_00227731 predicted 689
8 SASI_Rn02_00227732 predicted 486
9 SASI_Rn02_00227733 predicted 756
10 SASI_Rn02_00227734 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025834 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022437 predicted 1276
2 SASI_Mm01_00022438 predicted 1294
3 SASI_Mm02_00329106 predicted 1386
4 SASI_Mm01_00022439 predicted 780
5 SASI_Mm02_00329107 predicted 1114
6 SASI_Mm02_00329108 predicted 606
7 SASI_Mm02_00329109 predicted 771
8 SASI_Mm01_00022441 predicted 655
9 SASI_Mm01_00022442 predicted 738
10 SASI_Mm01_00022443 predicted 789
11 SASI_Mm01_00022436 predicted 1389
12 SASI_Mm01_00022440 predicted 609
13 SASI_Mm01_00022444 predicted 1178
14 SASI_Mm01_00022445 predicted 1139
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003891
PROZ MISSION shRNA Bacterial Glycerol Stock
protein Z, vitamin K-dependent plasma glycoprotein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003891.1-570s21c1
Sequence:CCGGTCCCGTGGCAGGTAAAGTTAACTCGAGTTAACTTTACCTGCCACGGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-1173s1c1
Sequence:CCGGCCAGGTACTCACTCTGGTTTACTCGAGTAAACCAGAGTGAGTACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-719s1c1
Sequence:CCGGGACCCGCTGATGATCAAGATACTCGAGTATCTTGATCATCAGCGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-241s1c1
Sequence:CCGGTGATGAATTCTGGAGACGATACTCGAGTATCGTCTCCAGAATTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-128s1c1
Sequence:CCGGGCGGGCTCCTATCTTCTGGAACTCGAGTTCCAGAAGATAGGAGCCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-618s1c1
Sequence:CCGGGTGGTGTTATAATACGGGAAACTCGAGTTTCCCGTATTATAACACCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003891.1-62s21c1
Sequence:CCGGCGTGTGGAGCCCTCAGTATTTCTCGAGAAATACTGAGGGCTCCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003891.1-666s21c1
Sequence:CCGGCACTGTTACACAGGAATATTACTCGAGTAATATTCCTGTGTAACAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003891
PROZ MISSION shRNA shRNA Plasmid DNA
protein Z, vitamin K-dependent plasma glycoprotein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003891.1-570s21c1
Sequence:CCGGTCCCGTGGCAGGTAAAGTTAACTCGAGTTAACTTTACCTGCCACGGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-1173s1c1
Sequence:CCGGCCAGGTACTCACTCTGGTTTACTCGAGTAAACCAGAGTGAGTACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-719s1c1
Sequence:CCGGGACCCGCTGATGATCAAGATACTCGAGTATCTTGATCATCAGCGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-241s1c1
Sequence:CCGGTGATGAATTCTGGAGACGATACTCGAGTATCGTCTCCAGAATTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-128s1c1
Sequence:CCGGGCGGGCTCCTATCTTCTGGAACTCGAGTTCCAGAAGATAGGAGCCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-618s1c1
Sequence:CCGGGTGGTGTTATAATACGGGAAACTCGAGTTTCCCGTATTATAACACCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003891.1-62s21c1
Sequence:CCGGCGTGTGGAGCCCTCAGTATTTCTCGAGAAATACTGAGGGCTCCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003891.1-666s21c1
Sequence:CCGGCACTGTTACACAGGAATATTACTCGAGTAATATTCCTGTGTAACAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003891
PROZ MISSION shRNA Lentiviral Transduction Particles
protein Z, vitamin K-dependent plasma glycoprotein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003891.1-570s21c1
Sequence:CCGGTCCCGTGGCAGGTAAAGTTAACTCGAGTTAACTTTACCTGCCACGGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-1173s1c1
Sequence:CCGGCCAGGTACTCACTCTGGTTTACTCGAGTAAACCAGAGTGAGTACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-719s1c1
Sequence:CCGGGACCCGCTGATGATCAAGATACTCGAGTATCTTGATCATCAGCGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-241s1c1
Sequence:CCGGTGATGAATTCTGGAGACGATACTCGAGTATCGTCTCCAGAATTCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-128s1c1
Sequence:CCGGGCGGGCTCCTATCTTCTGGAACTCGAGTTCCAGAAGATAGGAGCCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003891.1-618s1c1
Sequence:CCGGGTGGTGTTATAATACGGGAAACTCGAGTTTCCCGTATTATAACACCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378959    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003891.1-62s21c1
Sequence:CCGGCGTGTGGAGCCCTCAGTATTTCTCGAGAAATACTGAGGGCTCCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003891.1-666s21c1
Sequence:CCGGCACTGTTACACAGGAATATTACTCGAGTAATATTCCTGTGTAACAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025834
PROZ MISSION shRNA Bacterial Glycerol Stock
protein Z, vitamin K-dependent plasma glycoprotein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-1109s1c1
Sequence:CCGGCCCTGAATGTAACGGTCACTACTCGAGTAGTGACCGTTACATTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-657s1c1
Sequence:CCGGCGAACACATCAGAATGACAAACTCGAGTTTGTCATTCTGATGTGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-1285s1c1
Sequence:CCGGCCGAGATACTCCATGTGGTTTCTCGAGAAACCACATGGAGTATCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-804s1c1
Sequence:CCGGGCACAGCAACATCAGTGTAAACTCGAGTTTACACTGATGTTGCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-248s1c1
Sequence:CCGGGTTCGTACTTCCTGGAAGAAACTCGAGTTTCTTCCAGGAAGTACGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025834
PROZ MISSION shRNA shRNA Plasmid DNA
protein Z, vitamin K-dependent plasma glycoprotein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-1109s1c1
Sequence:CCGGCCCTGAATGTAACGGTCACTACTCGAGTAGTGACCGTTACATTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-657s1c1
Sequence:CCGGCGAACACATCAGAATGACAAACTCGAGTTTGTCATTCTGATGTGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-1285s1c1
Sequence:CCGGCCGAGATACTCCATGTGGTTTCTCGAGAAACCACATGGAGTATCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-804s1c1
Sequence:CCGGGCACAGCAACATCAGTGTAAACTCGAGTTTACACTGATGTTGCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-248s1c1
Sequence:CCGGGTTCGTACTTCCTGGAAGAAACTCGAGTTTCTTCCAGGAAGTACGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025834
PROZ MISSION shRNA Lentiviral Transduction Particles
protein Z, vitamin K-dependent plasma glycoprotein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-1109s1c1
Sequence:CCGGCCCTGAATGTAACGGTCACTACTCGAGTAGTGACCGTTACATTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031417    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-657s1c1
Sequence:CCGGCGAACACATCAGAATGACAAACTCGAGTTTGTCATTCTGATGTGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-1285s1c1
Sequence:CCGGCCGAGATACTCCATGTGGTTTCTCGAGAAACCACATGGAGTATCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031415    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-804s1c1
Sequence:CCGGGCACAGCAACATCAGTGTAAACTCGAGTTTACACTGATGTTGCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031418    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025834.2-248s1c1
Sequence:CCGGGTTCGTACTTCCTGGAAGAAACTCGAGTTTCTTCCAGGAAGTACGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)