EMAIL THIS PAGE TO A FRIEND

PRPF19

pre-mRNA processing factor 19

69 Gene Product Result for
Synonyms: NMP200 PRP19 PSO4 SNEV UBOX4 hPSO4
UniProtKB ID: Q9UMS4
Gene ID:
Human(27339) Summary: PSO4 is the human homolog of yeast Pso4, a gene essential for cell survival and DNA repair (Beck et al., 2008 [PubMed 18263876]
Mouse(28000) PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)
Rat(246216) pre-mRNA processing factor 19
naked mole-rat(101719630) pre-mRNA processing factor 19
domestic guinea pig(100722057) pre-mRNA processing factor 19
cow(513868) PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)
sheep(101121381) PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)
chicken(430767) PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)
Horse(100059076) PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)
domestic cat(101082262) PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)
dog(611552) PRP19/PSO4 pre-mRNA processing factor 19 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134129 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134129 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134129 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014502 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014502 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014502 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014502 Rosetta Predictions human pricing
NM_139333 Rosetta Predictions rat pricing
NM_134129 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031259 predicted 208
2 SASI_Hs01_00031260 predicted 1507
3 SASI_Hs01_00031261 predicted 1326
4 SASI_Hs01_00031262 predicted 729
5 SASI_Hs02_00345756 predicted 1327
6 SASI_Hs01_00031263 predicted 1485
7 SASI_Hs01_00031264 predicted 745
8 SASI_Hs01_00031265 predicted 1433
9 SASI_Hs01_00031266 predicted 1494
10 SASI_Hs01_00031267 predicted 964
11 SASI_Hs01_00031268 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061182 predicted 729
2 SASI_Rn01_00061183 predicted 1471
3 SASI_Rn01_00061184 predicted 291
4 SASI_Rn01_00061185 predicted 1050
5 SASI_Rn01_00061186 predicted 344
6 SASI_Rn01_00061187 predicted 918
7 SASI_Rn01_00061188 predicted 265
8 SASI_Rn01_00061189 predicted 1313
9 SASI_Rn01_00061190 predicted 249
10 SASI_Rn01_00061191 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134129 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174468 predicted 914
2 SASI_Mm01_00174469 predicted 406
3 SASI_Mm01_00174470 predicted 1412
4 SASI_Mm01_00174471 predicted 1381
5 SASI_Mm01_00174472 predicted 1439
6 SASI_Mm01_00174475 predicted 1299
7 SASI_Mm01_00174474 predicted 1454
8 SASI_Mm02_00339373 predicted 888
9 SASI_Mm01_00174476 predicted 500
10 SASI_Mm01_00174477 predicted 555
11 SASI_Mm01_00174473 predicted 263
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134129
PRPF19 MISSION shRNA Bacterial Glycerol Stock
pre-mRNA processing factor 19
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000327642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134129.3-239s21c1
Sequence:CCGGGCGACTCATTGAGAAGTACATCTCGAGATGTACTTCTCAATGAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134129.3-1652s21c1
Sequence:CCGGCCTCAAATTCTACAGTCTGTACTCGAGTACAGACTGTAGAATTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134129.3-1700s21c1
Sequence:CCGGCCTCATCTCAGTAGTGGGTTACTCGAGTAACCCACTACTGAGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-239s1c1
Sequence:CCGGGCGACTCATTGAGAAGTACATCTCGAGATGTACTTCTCAATGAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134129.2-1700s1c1
Sequence:CCGGCCTCATCTCAGTAGTGGGTTACTCGAGTAACCCACTACTGAGATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-1007s1c1
Sequence:CCGGCCCTGATGCTACTATCAGGATCTCGAGATCCTGATAGTAGCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-1652s1c1
Sequence:CCGGCCTCAAATTCTACAGTCTGTACTCGAGTACAGACTGTAGAATTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000102428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-240s1c1
Sequence:CCGGCGACTCATTGAGAAGTACATTCTCGAGAATGTACTTCTCAATGAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134129.3-1007s21c1
Sequence:CCGGCCCTGATGCTACTATCAGGATCTCGAGATCCTGATAGTAGCATCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134129
PRPF19 MISSION shRNA shRNA Plasmid DNA
pre-mRNA processing factor 19
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000327642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134129.3-239s21c1
Sequence:CCGGGCGACTCATTGAGAAGTACATCTCGAGATGTACTTCTCAATGAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134129.3-1652s21c1
Sequence:CCGGCCTCAAATTCTACAGTCTGTACTCGAGTACAGACTGTAGAATTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134129.3-1700s21c1
Sequence:CCGGCCTCATCTCAGTAGTGGGTTACTCGAGTAACCCACTACTGAGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-239s1c1
Sequence:CCGGGCGACTCATTGAGAAGTACATCTCGAGATGTACTTCTCAATGAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134129.2-1700s1c1
Sequence:CCGGCCTCATCTCAGTAGTGGGTTACTCGAGTAACCCACTACTGAGATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-1007s1c1
Sequence:CCGGCCCTGATGCTACTATCAGGATCTCGAGATCCTGATAGTAGCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-1652s1c1
Sequence:CCGGCCTCAAATTCTACAGTCTGTACTCGAGTACAGACTGTAGAATTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000102428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-240s1c1
Sequence:CCGGCGACTCATTGAGAAGTACATTCTCGAGAATGTACTTCTCAATGAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134129.3-1007s21c1
Sequence:CCGGCCCTGATGCTACTATCAGGATCTCGAGATCCTGATAGTAGCATCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134129
PRPF19 MISSION shRNA Lentiviral Transduction Particles
pre-mRNA processing factor 19
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000327642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134129.3-239s21c1
Sequence:CCGGGCGACTCATTGAGAAGTACATCTCGAGATGTACTTCTCAATGAGTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134129.3-1652s21c1
Sequence:CCGGCCTCAAATTCTACAGTCTGTACTCGAGTACAGACTGTAGAATTTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_134129.3-1700s21c1
Sequence:CCGGCCTCATCTCAGTAGTGGGTTACTCGAGTAACCCACTACTGAGATGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-239s1c1
Sequence:CCGGGCGACTCATTGAGAAGTACATCTCGAGATGTACTTCTCAATGAGTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102425    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134129.2-1700s1c1
Sequence:CCGGCCTCATCTCAGTAGTGGGTTACTCGAGTAACCCACTACTGAGATGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-1007s1c1
Sequence:CCGGCCCTGATGCTACTATCAGGATCTCGAGATCCTGATAGTAGCATCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-1652s1c1
Sequence:CCGGCCTCAAATTCTACAGTCTGTACTCGAGTACAGACTGTAGAATTTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000102428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134129.2-240s1c1
Sequence:CCGGCGACTCATTGAGAAGTACATTCTCGAGAATGTACTTCTCAATGAGTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000327617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134129.3-1007s21c1
Sequence:CCGGCCCTGATGCTACTATCAGGATCTCGAGATCCTGATAGTAGCATCAGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014502
VALIDATED
PRPF19 MISSION shRNA Bacterial Glycerol Stock
pre-mRNA processing factor 19
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1696s21c1
Sequence:CCGGCCTCAAGTTCTACAGCCTGTACTCGAGTACAGGCTGTAGAACTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1919s21c1
Sequence:CCGGGAACGGATGTGGAAGGAAGAACTCGAGTTCTTCCTTCCACATCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1334s21c1
Sequence:CCGGGACTTGAAGGAACGTACTAATCTCGAGATTAGTACGTTCCTTCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-257s1c1
Sequence:CCGGCCTGTCTCTAATCATGTTTATCTCGAGATAAACATGATTAGAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-284s21c1
Sequence:CCGGCGGCTCATCGAGAAGTACATTCTCGAGAATGTACTTCTCGATGAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-1919s1c1
Sequence:CCGGGAACGGATGTGGAAGGAAGAACTCGAGTTCTTCCTTCCACATCCGTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-1696s1c1
Sequence:CCGGCCTCAAGTTCTACAGCCTGTACTCGAGTACAGGCTGTAGAACTTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-1053s1c1
Sequence:CCGGCCGATGCCACTATCAGGATTTCTCGAGAAATCCTGATAGTGGCATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-284s1c1
Sequence:CCGGCGGCTCATCGAGAAGTACATTCTCGAGAATGTACTTCTCGATGAGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1464s21c1
Sequence:CCGGTGCGCAAGCTTAAGAACTTTACTCGAGTAAAGTTCTTAAGCTTGCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014502
VALIDATED
PRPF19 MISSION shRNA shRNA Plasmid DNA
pre-mRNA processing factor 19
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1696s21c1
Sequence:CCGGCCTCAAGTTCTACAGCCTGTACTCGAGTACAGGCTGTAGAACTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1919s21c1
Sequence:CCGGGAACGGATGTGGAAGGAAGAACTCGAGTTCTTCCTTCCACATCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1334s21c1
Sequence:CCGGGACTTGAAGGAACGTACTAATCTCGAGATTAGTACGTTCCTTCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-257s1c1
Sequence:CCGGCCTGTCTCTAATCATGTTTATCTCGAGATAAACATGATTAGAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-284s21c1
Sequence:CCGGCGGCTCATCGAGAAGTACATTCTCGAGAATGTACTTCTCGATGAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-1919s1c1
Sequence:CCGGGAACGGATGTGGAAGGAAGAACTCGAGTTCTTCCTTCCACATCCGTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-1696s1c1
Sequence:CCGGCCTCAAGTTCTACAGCCTGTACTCGAGTACAGGCTGTAGAACTTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-1053s1c1
Sequence:CCGGCCGATGCCACTATCAGGATTTCTCGAGAAATCCTGATAGTGGCATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-284s1c1
Sequence:CCGGCGGCTCATCGAGAAGTACATTCTCGAGAATGTACTTCTCGATGAGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1464s21c1
Sequence:CCGGTGCGCAAGCTTAAGAACTTTACTCGAGTAAAGTTCTTAAGCTTGCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014502
VALIDATED
PRPF19 MISSION shRNA Lentiviral Transduction Particles
pre-mRNA processing factor 19
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1696s21c1
Sequence:CCGGCCTCAAGTTCTACAGCCTGTACTCGAGTACAGGCTGTAGAACTTGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272713    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1919s21c1
Sequence:CCGGGAACGGATGTGGAAGGAAGAACTCGAGTTCTTCCTTCCACATCCGTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1334s21c1
Sequence:CCGGGACTTGAAGGAACGTACTAATCTCGAGATTAGTACGTTCCTTCAAGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006593    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-257s1c1
Sequence:CCGGCCTGTCTCTAATCATGTTTATCTCGAGATAAACATGATTAGAGACAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-284s21c1
Sequence:CCGGCGGCTCATCGAGAAGTACATTCTCGAGAATGTACTTCTCGATGAGCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006592    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-1919s1c1
Sequence:CCGGGAACGGATGTGGAAGGAAGAACTCGAGTTCTTCCTTCCACATCCGTTCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-1696s1c1
Sequence:CCGGCCTCAAGTTCTACAGCCTGTACTCGAGTACAGGCTGTAGAACTTGAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-1053s1c1
Sequence:CCGGCCGATGCCACTATCAGGATTTCTCGAGAAATCCTGATAGTGGCATCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000006595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_014502.3-284s1c1
Sequence:CCGGCGGCTCATCGAGAAGTACATTCTCGAGAATGTACTTCTCGATGAGCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_014502.3-1464s21c1
Sequence:CCGGTGCGCAAGCTTAAGAACTTTACTCGAGTAAAGTTCTTAAGCTTGCGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???