EMAIL THIS PAGE TO A FRIEND

PRPF31

pre-mRNA processing factor 31

49 Gene Product Result for
Synonyms: NY-BR-99 PRP31 RP11 SNRNP61
UniProtKB ID: Q8WWY3, Q17RB4, Q8N7F9, Q9H271, Q9Y439
Gene ID:
Human(26121) Summary: This gene encodes a component of the spliceosome complex and is one of several retinitis pigmentosa-causing genes. When the gene product is added to the spliceosome complex, activation occurs.[provided by RefSeq, Jan 2009]
Mouse(68988) PRP31 pre-mRNA processing factor 31 homolog (yeast)
Rat(292536) pre-mRNA processing factor 31
naked mole-rat(101697344) pre-mRNA processing factor 31
domestic guinea pig(100734228) pre-mRNA processing factor 31
cow(513577) PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)
sheep(101103004) PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)
Zebrafish(393476) PRP31 pre-mRNA processing factor 31 homolog (yeast)
dog(476389) PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)
Horse(100049878) PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)
domestic cat(101101271) PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015629 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015629 Rosetta Predictions human pricing
NM_001106219 Rosetta Predictions rat pricing
NM_027328 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048860 predicted 766
2 SASI_Hs01_00048861 predicted 1484
3 SASI_Hs01_00048862 predicted 1798
4 SASI_Hs01_00048863 predicted 1834
5 SASI_Hs01_00048864 predicted 1634
6 SASI_Hs01_00048865 predicted 1653
7 SASI_Hs01_00048866 predicted 1467
8 SASI_Hs01_00048867 predicted 1784
9 SASI_Hs01_00048868 predicted 1838
10 SASI_Hs01_00048869 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106219 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216808 predicted 364
2 SASI_Rn02_00216809 predicted 1031
3 SASI_Rn02_00216810 predicted 907
4 SASI_Rn02_00216811 predicted 1347
5 SASI_Rn02_00216812 predicted 476
6 SASI_Rn02_00216813 predicted 294
7 SASI_Rn02_00216814 predicted 723
8 SASI_Rn02_00216815 predicted 729
9 SASI_Rn02_00216816 predicted 516
10 SASI_Rn02_00216817 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042597 predicted 364
2 SASI_Mm02_00331963 predicted 1358
3 SASI_Mm01_00042599 predicted 559
4 SASI_Mm01_00042600 predicted 243
5 SASI_Mm02_00331964 predicted 351
6 SASI_Mm01_00042602 predicted 1379
7 SASI_Mm01_00042603 predicted 1223
8 SASI_Mm01_00042604 predicted 726
9 SASI_Mm01_00042605 predicted 405
10 SASI_Mm01_00042606 predicted 1251
11 SASI_Mm01_00042598 predicted 273
12 SASI_Mm01_00042601 predicted 910
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027328
VALIDATED
PRPF31 MISSION shRNA Bacterial Glycerol Stock
pre-mRNA processing factor 31
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-881s21c1
Sequence:CCGGGTTGCCTCATACTGGTTATATCTCGAGATATAACCAGTATGAGGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-1603s21c1
Sequence:CCGGCATCCACTGAAAGGACATAAACTCGAGTTTATGTCCTTTCAGTGGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027328.4-1045s21c1
Sequence:CCGGATGAGATTGAGCGCAAATTTGCTCGAGCAAATTTGCGCTCAATCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027328.2-1964s1c1
Sequence:CCGGCCAGCTCTCTTCTGCTCTTATCTCGAGATAAGAGCAGAAGAGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027328.2-426s1c1
Sequence:CCGGCGGGATAAATACTCAAAGAGACTCGAGTCTCTTTGAGTATTTATCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-272s21c1
Sequence:CCGGGATGAAGATTGAGGAGTATATCTCGAGATATACTCCTCAATCTTCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027328.2-884s1c1
Sequence:CCGGGTTGCCTCATACTGGTTATATCTCGAGATATAACCAGTATGAGGCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027328.2-518s1c1
Sequence:CCGGCCTGGATAAGTGCAAGAACAACTCGAGTTGTTCTTGCACTTATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000103727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027328.2-1511s1c1
Sequence:CCGGCCAGAAGTATTTCTCTAGCATCTCGAGATGCTAGAGAAATACTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-1022s21c1
Sequence:CCGGGAAGGTGGGCTACGAACTAAACTCGAGTTTAGTTCGTAGCCCACCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027328
VALIDATED
PRPF31 MISSION shRNA shRNA Plasmid DNA
pre-mRNA processing factor 31
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-881s21c1
Sequence:CCGGGTTGCCTCATACTGGTTATATCTCGAGATATAACCAGTATGAGGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-1603s21c1
Sequence:CCGGCATCCACTGAAAGGACATAAACTCGAGTTTATGTCCTTTCAGTGGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027328.4-1045s21c1
Sequence:CCGGATGAGATTGAGCGCAAATTTGCTCGAGCAAATTTGCGCTCAATCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027328.2-1964s1c1
Sequence:CCGGCCAGCTCTCTTCTGCTCTTATCTCGAGATAAGAGCAGAAGAGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027328.2-426s1c1
Sequence:CCGGCGGGATAAATACTCAAAGAGACTCGAGTCTCTTTGAGTATTTATCCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-272s21c1
Sequence:CCGGGATGAAGATTGAGGAGTATATCTCGAGATATACTCCTCAATCTTCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027328.2-884s1c1
Sequence:CCGGGTTGCCTCATACTGGTTATATCTCGAGATATAACCAGTATGAGGCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027328.2-518s1c1
Sequence:CCGGCCTGGATAAGTGCAAGAACAACTCGAGTTGTTCTTGCACTTATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000103727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027328.2-1511s1c1
Sequence:CCGGCCAGAAGTATTTCTCTAGCATCTCGAGATGCTAGAGAAATACTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-1022s21c1
Sequence:CCGGGAAGGTGGGCTACGAACTAAACTCGAGTTTAGTTCGTAGCCCACCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027328
VALIDATED
PRPF31 MISSION shRNA Lentiviral Transduction Particles
pre-mRNA processing factor 31
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-881s21c1
Sequence:CCGGGTTGCCTCATACTGGTTATATCTCGAGATATAACCAGTATGAGGCAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-1603s21c1
Sequence:CCGGCATCCACTGAAAGGACATAAACTCGAGTTTATGTCCTTTCAGTGGATGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027328.4-1045s21c1
Sequence:CCGGATGAGATTGAGCGCAAATTTGCTCGAGCAAATTTGCGCTCAATCTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103725    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027328.2-1964s1c1
Sequence:CCGGCCAGCTCTCTTCTGCTCTTATCTCGAGATAAGAGCAGAAGAGAGCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027328.2-426s1c1
Sequence:CCGGCGGGATAAATACTCAAAGAGACTCGAGTCTCTTTGAGTATTTATCCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305807    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-272s21c1
Sequence:CCGGGATGAAGATTGAGGAGTATATCTCGAGATATACTCCTCAATCTTCATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027328.2-884s1c1
Sequence:CCGGGTTGCCTCATACTGGTTATATCTCGAGATATAACCAGTATGAGGCAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103726    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027328.2-518s1c1
Sequence:CCGGCCTGGATAAGTGCAAGAACAACTCGAGTTGTTCTTGCACTTATCCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000103727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027328.2-1511s1c1
Sequence:CCGGCCAGAAGTATTTCTCTAGCATCTCGAGATGCTAGAGAAATACTTCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305809    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027328.4-1022s21c1
Sequence:CCGGGAAGGTGGGCTACGAACTAAACTCGAGTTTAGTTCGTAGCCCACCTTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015629
VALIDATED
PRPF31 MISSION shRNA Bacterial Glycerol Stock
pre-mRNA processing factor 31
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015629.2-548s21c1
Sequence:CCGGTGATGAAGATTGAGGAGTATACTCGAGTATACTCCTCAATCTTCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015629.2-798s21c1
Sequence:CCGGCAAGTGCAAGAACAATGAGAACTCGAGTTCTCATTGTTCTTGCACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015629.2-1003s21c1
Sequence:CCGGGCACCCAACCTGTCCATCATTCTCGAGAATGATGGACAGGTTGGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015629.2-697s21c1
Sequence:CCGGATCCGGGATAAGTACTCAAAGCTCGAGCTTTGAGTACTTATCCCGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-681s1c1
Sequence:CCGGGCACCCAACCTGTCCATCATTCTCGAGAATGATGGACAGGTTGGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-1705s1c1
Sequence:CCGGACCGAGATCACCGCCCAGTATCTCGAGATACTGGGCGGTGATCTCGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-476s1c1
Sequence:CCGGCAAGTGCAAGAACAATGAGAACTCGAGTTCTCATTGTTCTTGCACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015629.x-986s1c1
Sequence:CCGGCTACGAACTGAAGGATGAGATCTCGAGATCTCATCCTTCAGTTCGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-226s1c1
Sequence:CCGGTGATGAAGATTGAGGAGTATACTCGAGTATACTCCTCAATCTTCATCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015629.2-1910s21c1
Sequence:CCGGTCCTTCTGAAGGGCTAGGATCCTCGAGGATCCTAGCCCTTCAGAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015629
VALIDATED
PRPF31 MISSION shRNA shRNA Plasmid DNA
pre-mRNA processing factor 31
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015629.2-548s21c1
Sequence:CCGGTGATGAAGATTGAGGAGTATACTCGAGTATACTCCTCAATCTTCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015629.2-798s21c1
Sequence:CCGGCAAGTGCAAGAACAATGAGAACTCGAGTTCTCATTGTTCTTGCACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015629.2-1003s21c1
Sequence:CCGGGCACCCAACCTGTCCATCATTCTCGAGAATGATGGACAGGTTGGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015629.2-697s21c1
Sequence:CCGGATCCGGGATAAGTACTCAAAGCTCGAGCTTTGAGTACTTATCCCGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-681s1c1
Sequence:CCGGGCACCCAACCTGTCCATCATTCTCGAGAATGATGGACAGGTTGGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-1705s1c1
Sequence:CCGGACCGAGATCACCGCCCAGTATCTCGAGATACTGGGCGGTGATCTCGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-476s1c1
Sequence:CCGGCAAGTGCAAGAACAATGAGAACTCGAGTTCTCATTGTTCTTGCACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015629.x-986s1c1
Sequence:CCGGCTACGAACTGAAGGATGAGATCTCGAGATCTCATCCTTCAGTTCGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-226s1c1
Sequence:CCGGTGATGAAGATTGAGGAGTATACTCGAGTATACTCCTCAATCTTCATCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015629.2-1910s21c1
Sequence:CCGGTCCTTCTGAAGGGCTAGGATCCTCGAGGATCCTAGCCCTTCAGAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015629
VALIDATED
PRPF31 MISSION shRNA Lentiviral Transduction Particles
pre-mRNA processing factor 31
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015629.2-548s21c1
Sequence:CCGGTGATGAAGATTGAGGAGTATACTCGAGTATACTCCTCAATCTTCATCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_015629.2-798s21c1
Sequence:CCGGCAAGTGCAAGAACAATGAGAACTCGAGTTCTCATTGTTCTTGCACTTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_015629.2-1003s21c1
Sequence:CCGGGCACCCAACCTGTCCATCATTCTCGAGAATGATGGACAGGTTGGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272813    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015629.2-697s21c1
Sequence:CCGGATCCGGGATAAGTACTCAAAGCTCGAGCTTTGAGTACTTATCCCGGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-681s1c1
Sequence:CCGGGCACCCAACCTGTCCATCATTCTCGAGAATGATGGACAGGTTGGGTGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-1705s1c1
Sequence:CCGGACCGAGATCACCGCCCAGTATCTCGAGATACTGGGCGGTGATCTCGGTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-476s1c1
Sequence:CCGGCAAGTGCAAGAACAATGAGAACTCGAGTTCTCATTGTTCTTGCACTTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001183    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015629.x-986s1c1
Sequence:CCGGCTACGAACTGAAGGATGAGATCTCGAGATCTCATCCTTCAGTTCGTAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_015629.x-226s1c1
Sequence:CCGGTGATGAAGATTGAGGAGTATACTCGAGTATACTCCTCAATCTTCATCATTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000272758    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015629.2-1910s21c1
Sequence:CCGGTCCTTCTGAAGGGCTAGGATCCTCGAGGATCCTAGCCCTTCAGAAGGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???