EMAIL THIS PAGE TO A FRIEND

PRPF38A

PRP38 pre-mRNA processing factor 38 (yeast) domain containing A

63 Gene Product Result for
Synonyms: Prp38 RP5-965L7.1
UniProtKB ID: Q8NAV1, Q96JW1, Q9BVZ8
Gene ID:
Mouse(230596) PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Rat(298374) PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Zebrafish(445089) PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
dog(475350) PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
domestic cat(101091130) PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
chicken(771795) PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
cow(507240) PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
sheep(101115326) PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
domestic guinea pig(100724437) PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
naked mole-rat(101711167) PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172697 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172697 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172697 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032284 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032284 Rosetta Predictions human pricing
NM_032864 Rosetta Predictions human pricing
NM_001106672 Rosetta Predictions rat pricing
NM_172697 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062482 predicted 632
2 SASI_Hs01_00062483 predicted 755
3 SASI_Hs01_00062484 predicted 505
4 SASI_Hs01_00062485 predicted 685
5 SASI_Hs01_00062486 predicted 670
6 SASI_Hs01_00062487 predicted 652
7 SASI_Hs01_00062488 predicted 778
8 SASI_Hs01_00062489 predicted 711
9 SASI_Hs01_00062490 predicted 600
10 SASI_Hs01_00062491 predicted 562
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032864 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360464 predicted 556
2 SASI_Hs02_00360465 predicted 451
3 SASI_Hs02_00360466 predicted 272
4 SASI_Hs02_00360467 predicted 282
5 SASI_Hs01_00195259 predicted 1189
6 SASI_Hs02_00360468 predicted 534
7 SASI_Hs02_00360469 predicted 733
8 SASI_Hs02_00360470 predicted 378
9 SASI_Hs02_00360471 predicted 1172
10 SASI_Hs02_00360472 predicted 259
11 SASI_Hs01_00195253 predicted 1028
12 SASI_Hs01_00195254 predicted 1153
13 SASI_Hs01_00195255 predicted 906
14 SASI_Hs01_00195256 predicted 1081
15 SASI_Hs01_00195257 predicted 1069
16 SASI_Hs01_00195258 predicted 1050
17 SASI_Hs01_00195260 predicted 1109
18 SASI_Hs01_00195261 predicted 1000
19 SASI_Hs01_00195262 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106672 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221248 predicted 420
2 SASI_Rn02_00221249 predicted 1062
3 SASI_Rn02_00221250 predicted 1135
4 SASI_Rn02_00221251 predicted 1109
5 SASI_Rn02_00221252 predicted 833
6 SASI_Rn02_00221253 predicted 379
7 SASI_Rn02_00221254 predicted 483
8 SASI_Rn02_00221255 predicted 450
9 SASI_Rn02_00221256 predicted 278
10 SASI_Rn02_00221257 predicted 1066
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172697 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040591 predicted 734
2 SASI_Mm01_00040582 predicted 386
3 SASI_Mm01_00040583 predicted 375
4 SASI_Mm01_00040584 predicted 618
5 SASI_Mm02_00344445 predicted 332
6 SASI_Mm01_00040585 predicted 635
7 SASI_Mm01_00040586 predicted 465
8 SASI_Mm02_00344446 predicted 851
9 SASI_Mm02_00344447 predicted 859
10 SASI_Mm01_00040587 predicted 569
11 SASI_Mm01_00040588 predicted 925
12 SASI_Mm01_00040589 predicted 385
13 SASI_Mm01_00040590 predicted 495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172697
VALIDATED
PRPF38A MISSION shRNA Bacterial Glycerol Stock
PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000305402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-686s21c1
Sequence:CCGGAGAGAGTCTGTGATATCATTTCTCGAGAAATGATATCACAGACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-549s21c1
Sequence:CCGGCACAGGAACTGCAATTGATTGCTCGAGCAATCAATTGCAGTTCCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-295s1c1
Sequence:CCGGGCGAATCTATGAATCAAAGTACTCGAGTACTTTGATTCATAGATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-292s1c1
Sequence:CCGGGACGCGAATCTATGAATCAAACTCGAGTTTGATTCATAGATTCGCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172697.1-1159s1c1
Sequence:CCGGGCATCTTGACTTTGGTCCAAACTCGAGTTTGGACCAAAGTCAAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-1097s21c1
Sequence:CCGGGCCACTCAAAGTCTCCTGAAACTCGAGTTTCAGGAGACTTTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-1089s1c1
Sequence:CCGGGCCACTCAAAGTCTCCTGAAACTCGAGTTTCAGGAGACTTTGAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-639s1c1
Sequence:CCGGTGCATGTAGATGAGTTCATTTCTCGAGAAATGAACTCATCTACATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-1167s21c1
Sequence:CCGGGCATCTTGACTTTGGTCCAAACTCGAGTTTGGACCAAAGTCAAGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000305401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-610s21c1
Sequence:CCGGATCAAGAGCCAGAACCGAAATCTCGAGATTTCGGTTCTGGCTCTTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172697
VALIDATED
PRPF38A MISSION shRNA shRNA Plasmid DNA
PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000305402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-686s21c1
Sequence:CCGGAGAGAGTCTGTGATATCATTTCTCGAGAAATGATATCACAGACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-549s21c1
Sequence:CCGGCACAGGAACTGCAATTGATTGCTCGAGCAATCAATTGCAGTTCCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-295s1c1
Sequence:CCGGGCGAATCTATGAATCAAAGTACTCGAGTACTTTGATTCATAGATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-292s1c1
Sequence:CCGGGACGCGAATCTATGAATCAAACTCGAGTTTGATTCATAGATTCGCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172697.1-1159s1c1
Sequence:CCGGGCATCTTGACTTTGGTCCAAACTCGAGTTTGGACCAAAGTCAAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-1097s21c1
Sequence:CCGGGCCACTCAAAGTCTCCTGAAACTCGAGTTTCAGGAGACTTTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-1089s1c1
Sequence:CCGGGCCACTCAAAGTCTCCTGAAACTCGAGTTTCAGGAGACTTTGAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-639s1c1
Sequence:CCGGTGCATGTAGATGAGTTCATTTCTCGAGAAATGAACTCATCTACATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-1167s21c1
Sequence:CCGGGCATCTTGACTTTGGTCCAAACTCGAGTTTGGACCAAAGTCAAGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000305401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-610s21c1
Sequence:CCGGATCAAGAGCCAGAACCGAAATCTCGAGATTTCGGTTCTGGCTCTTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172697
VALIDATED
PRPF38A MISSION shRNA Lentiviral Transduction Particles
PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000305402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-686s21c1
Sequence:CCGGAGAGAGTCTGTGATATCATTTCTCGAGAAATGATATCACAGACTCTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-549s21c1
Sequence:CCGGCACAGGAACTGCAATTGATTGCTCGAGCAATCAATTGCAGTTCCTGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123761    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-295s1c1
Sequence:CCGGGCGAATCTATGAATCAAAGTACTCGAGTACTTTGATTCATAGATTCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-292s1c1
Sequence:CCGGGACGCGAATCTATGAATCAAACTCGAGTTTGATTCATAGATTCGCGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123759    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172697.1-1159s1c1
Sequence:CCGGGCATCTTGACTTTGGTCCAAACTCGAGTTTGGACCAAAGTCAAGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000309577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-1097s21c1
Sequence:CCGGGCCACTCAAAGTCTCCTGAAACTCGAGTTTCAGGAGACTTTGAGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-1089s1c1
Sequence:CCGGGCCACTCAAAGTCTCCTGAAACTCGAGTTTCAGGAGACTTTGAGTGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000123763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172697.1-639s1c1
Sequence:CCGGTGCATGTAGATGAGTTCATTTCTCGAGAAATGAACTCATCTACATGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000309576    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-1167s21c1
Sequence:CCGGGCATCTTGACTTTGGTCCAAACTCGAGTTTGGACCAAAGTCAAGATGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000305401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172697.3-610s21c1
Sequence:CCGGATCAAGAGCCAGAACCGAAATCTCGAGATTTCGGTTCTGGCTCTTGATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032284
PRPF38A MISSION shRNA Bacterial Glycerol Stock
PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032284.2-932s1c1
Sequence:CCGGCCTTGACTGTATTCAAACTTACTCGAGTAAGTTTGAATACAGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-607s1c1
Sequence:CCGGGCGGCACAGATCCCGTTCCAACTCGAGTTGGAACGGGATCTGTGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-427s1c1
Sequence:CCGGCCGGAGAAGCTACCGAGACTTCTCGAGAAGTCTCGGTAGCTTCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-393s1c1
Sequence:CCGGAGAAGTTGGAAAGAGTGCCATCTCGAGATGGCACTCTTTCCAACTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-673s1c1
Sequence:CCGGGTCTCCCGAAAGGTCTAAGAACTCGAGTTCTTAGACCTTTCGGGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032284
PRPF38A MISSION shRNA shRNA Plasmid DNA
PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032284.2-932s1c1
Sequence:CCGGCCTTGACTGTATTCAAACTTACTCGAGTAAGTTTGAATACAGTCAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-607s1c1
Sequence:CCGGGCGGCACAGATCCCGTTCCAACTCGAGTTGGAACGGGATCTGTGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-427s1c1
Sequence:CCGGCCGGAGAAGCTACCGAGACTTCTCGAGAAGTCTCGGTAGCTTCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-393s1c1
Sequence:CCGGAGAAGTTGGAAAGAGTGCCATCTCGAGATGGCACTCTTTCCAACTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-673s1c1
Sequence:CCGGGTCTCCCGAAAGGTCTAAGAACTCGAGTTCTTAGACCTTTCGGGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032284
PRPF38A MISSION shRNA Lentiviral Transduction Particles
PRP38 pre-mRNA processing factor 38 (yeast) domain containing A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074908    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_032284.2-932s1c1
Sequence:CCGGCCTTGACTGTATTCAAACTTACTCGAGTAAGTTTGAATACAGTCAAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-607s1c1
Sequence:CCGGGCGGCACAGATCCCGTTCCAACTCGAGTTGGAACGGGATCTGTGCCGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-427s1c1
Sequence:CCGGCCGGAGAAGCTACCGAGACTTCTCGAGAAGTCTCGGTAGCTTCTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-393s1c1
Sequence:CCGGAGAAGTTGGAAAGAGTGCCATCTCGAGATGGCACTCTTTCCAACTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000074909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032284.2-673s1c1
Sequence:CCGGGTCTCCCGAAAGGTCTAAGAACTCGAGTTCTTAGACCTTTCGGGAGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???