EMAIL THIS PAGE TO A FRIEND

PRPF3

pre-mRNA processing factor 3

67 Gene Product Result for
Synonyms: HPRP3 HPRP3P PRP3 Prp3p RP18 SNRNP90
UniProtKB ID: O43395, O43446, Q5VT54
Gene ID:
Human(9129) Summary: The removal of introns from nuclear pre-mRNAs occurs on complexes called spliceosomes, which are made up of 4 small nuclear ribonucleoprotein (snRNP) particles and an undefined number of transiently associated splicing factors. This gene product is one of several proteins that associate with U4 and U6 snRNPs. Mutations in this gene are associated with retinitis pigmentosa-18. [provided by RefSeq, Jul 2008]
Mouse(70767) PRP3 pre-mRNA processing factor 3 homolog (yeast)
Rat(361995) pre-mRNA processing factor 3
Zebrafish(403072) PRP3 pre-mRNA processing factor 3 homolog (yeast)
Horse(100054622) PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)
domestic cat(101084383) PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)
dog(475836) PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)
chicken(426667) PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)
cow(510322) PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)
sheep(101104702) PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)
domestic guinea pig(100732717) pre-mRNA processing factor 3
naked mole-rat(101720204) pre-mRNA processing factor 3
Domestic Rabbit(100340411) PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004698 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004698 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004698 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027541 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027541 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027541 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU024431 MISSION® esiRNA esiRNA human PRPF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004698 Rosetta Predictions human pricing
NM_001108559 Rosetta Predictions rat pricing
NM_027541 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177707 predicted 1997
2 SASI_Hs01_00177708 predicted 608
3 SASI_Hs01_00177709 predicted 1951
4 SASI_Hs01_00177710 predicted 1368
5 SASI_Hs01_00177711 predicted 1076
6 SASI_Hs01_00177712 predicted 482
7 SASI_Hs01_00177714 predicted 1844
8 SASI_Hs01_00177715 predicted 1091
9 SASI_Hs01_00177716 predicted 344
10 SASI_Hs02_00338148 predicted 1113
11 SASI_Hs01_00177713 predicted 1345
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239829 predicted 1214
2 SASI_Rn02_00239830 predicted 1483
3 SASI_Rn02_00239831 predicted 912
4 SASI_Rn02_00239832 predicted 1816
5 SASI_Rn02_00239833 predicted 1308
6 SASI_Rn02_00239834 predicted 335
7 SASI_Rn02_00239835 predicted 1674
8 SASI_Rn02_00239836 predicted 1241
9 SASI_Rn02_00239837 predicted 1781
10 SASI_Rn02_00239838 predicted 1013
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027541 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332383 predicted 1571
2 SASI_Mm02_00332384 predicted 1630
3 SASI_Mm01_00157310 predicted 1190
4 SASI_Mm01_00157312 predicted 1071
5 SASI_Mm02_00332385 predicted 1733
6 SASI_Mm01_00157314 predicted 933
7 SASI_Mm01_00157315 predicted 2110
8 SASI_Mm01_00157316 predicted 654
9 SASI_Mm01_00157318 predicted 908
10 SASI_Mm02_00332386 predicted 2412
11 SASI_Mm01_00157311 predicted 1545
12 SASI_Mm01_00157313 predicted 1999
13 SASI_Mm01_00157317 predicted 684
14 SASI_Mm01_00157319 predicted 1253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004698
VALIDATED
PRPF3 MISSION shRNA Bacterial Glycerol Stock
pre-mRNA processing factor 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-2169s1c1
Sequence:CCGGCAGTCCTCTCACTTATTCTATCTCGAGATAGAATAAGTGAGAGGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004698.1-1858s1c1
Sequence:CCGGCGTCTTATGCTGCATCGGATACTCGAGTATCCGATGCAGCATAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-907s1c1
Sequence:CCGGCCTACTCTGAAAGCCAATATTCTCGAGAATATTGGCTTTCAGAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-2089s1c1
Sequence:CCGGGCGCTGAGTGAATCTGTGTTACTCGAGTAACACAGATTCACTCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-906s1c1
Sequence:CCGGGCCTACTCTGAAAGCCAATATCTCGAGATATTGGCTTTCAGAGTAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-1460s21c1
Sequence:CCGGCAGTTACTCTGGGAGTATATCCTCGAGGATATACTCCCAGAGTAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004698.2-1597s21c1
Sequence:CCGGTCTAATTTGATGCGAGTATTACTCGAGTAATACTCGCATCAAATTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-2179s21c1
Sequence:CCGGGCGCTGAGTGAATCTGTGTTACTCGAGTAACACAGATTCACTCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-2295s21c1
Sequence:CCGGCACTTGTTTGTGTGATCTCAGCTCGAGCTGAGATCACACAAACAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-1147s21c1
Sequence:CCGGTTCCATGACAAGGGCAAATTTCTCGAGAAATTTGCCCTTGTCATGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004698
VALIDATED
PRPF3 MISSION shRNA shRNA Plasmid DNA
pre-mRNA processing factor 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-2169s1c1
Sequence:CCGGCAGTCCTCTCACTTATTCTATCTCGAGATAGAATAAGTGAGAGGACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004698.1-1858s1c1
Sequence:CCGGCGTCTTATGCTGCATCGGATACTCGAGTATCCGATGCAGCATAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-907s1c1
Sequence:CCGGCCTACTCTGAAAGCCAATATTCTCGAGAATATTGGCTTTCAGAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-2089s1c1
Sequence:CCGGGCGCTGAGTGAATCTGTGTTACTCGAGTAACACAGATTCACTCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-906s1c1
Sequence:CCGGGCCTACTCTGAAAGCCAATATCTCGAGATATTGGCTTTCAGAGTAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-1460s21c1
Sequence:CCGGCAGTTACTCTGGGAGTATATCCTCGAGGATATACTCCCAGAGTAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004698.2-1597s21c1
Sequence:CCGGTCTAATTTGATGCGAGTATTACTCGAGTAATACTCGCATCAAATTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-2179s21c1
Sequence:CCGGGCGCTGAGTGAATCTGTGTTACTCGAGTAACACAGATTCACTCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-2295s21c1
Sequence:CCGGCACTTGTTTGTGTGATCTCAGCTCGAGCTGAGATCACACAAACAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-1147s21c1
Sequence:CCGGTTCCATGACAAGGGCAAATTTCTCGAGAAATTTGCCCTTGTCATGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004698
VALIDATED
PRPF3 MISSION shRNA Lentiviral Transduction Particles
pre-mRNA processing factor 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-2169s1c1
Sequence:CCGGCAGTCCTCTCACTTATTCTATCTCGAGATAGAATAAGTGAGAGGACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004698.1-1858s1c1
Sequence:CCGGCGTCTTATGCTGCATCGGATACTCGAGTATCCGATGCAGCATAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-907s1c1
Sequence:CCGGCCTACTCTGAAAGCCAATATTCTCGAGAATATTGGCTTTCAGAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-2089s1c1
Sequence:CCGGGCGCTGAGTGAATCTGTGTTACTCGAGTAACACAGATTCACTCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004698.1-906s1c1
Sequence:CCGGGCCTACTCTGAAAGCCAATATCTCGAGATATTGGCTTTCAGAGTAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-1460s21c1
Sequence:CCGGCAGTTACTCTGGGAGTATATCCTCGAGGATATACTCCCAGAGTAACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004698.2-1597s21c1
Sequence:CCGGTCTAATTTGATGCGAGTATTACTCGAGTAATACTCGCATCAAATTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-2179s21c1
Sequence:CCGGGCGCTGAGTGAATCTGTGTTACTCGAGTAACACAGATTCACTCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294057    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-2295s21c1
Sequence:CCGGCACTTGTTTGTGTGATCTCAGCTCGAGCTGAGATCACACAAACAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004698.2-1147s21c1
Sequence:CCGGTTCCATGACAAGGGCAAATTTCTCGAGAAATTTGCCCTTGTCATGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027541
VALIDATED
PRPF3 MISSION shRNA Bacterial Glycerol Stock
pre-mRNA processing factor 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027541.2-2550s1c1
Sequence:CCGGCCTTGTATCTTCTTTGCCTTTCTCGAGAAAGGCAAAGAAGATACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027541.2-749s1c1
Sequence:CCGGCGAGAGTTAAAGGAGGTGTTTCTCGAGAAACACCTCCTTTAACTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027541.2-1903s1c1
Sequence:CCGGGCCCAAAGTGAGAATCTCAAACTCGAGTTTGAGATTCTCACTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027541.2-2270s1c1
Sequence:CCGGCGTCTCATGCTACATCGGATACTCGAGTATCCGATGTAGCATGAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027541.2-935s1c1
Sequence:CCGGCGACAAATCGAGGAACGGAAACTCGAGTTTCCGTTCCTCGATTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027541.4-2537s21c1
Sequence:CCGGACTACTGTTAGCCCTTGTATCCTCGAGGATACAAGGGCTAACAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027541.4-2271s21c1
Sequence:CCGGTCTCATGCTACATCGGATAAACTCGAGTTTATCCGATGTAGCATGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027541.4-1469s21c1
Sequence:CCGGTCCATGACAAGGGCAAATTTGCTCGAGCAAATTTGCCCTTGTCATGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027541.4-2116s21c1
Sequence:CCGGGTGTATAGAGTTCGAAATTTGCTCGAGCAAATTTCGAACTCTATACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027541.4-1507s21c1
Sequence:CCGGTTACGGACAAAGGCTCAATTGCTCGAGCAATTGAGCCTTTGTCCGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027541
VALIDATED
PRPF3 MISSION shRNA shRNA Plasmid DNA
pre-mRNA processing factor 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027541.2-2550s1c1
Sequence:CCGGCCTTGTATCTTCTTTGCCTTTCTCGAGAAAGGCAAAGAAGATACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027541.2-749s1c1
Sequence:CCGGCGAGAGTTAAAGGAGGTGTTTCTCGAGAAACACCTCCTTTAACTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027541.2-1903s1c1
Sequence:CCGGGCCCAAAGTGAGAATCTCAAACTCGAGTTTGAGATTCTCACTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027541.2-2270s1c1
Sequence:CCGGCGTCTCATGCTACATCGGATACTCGAGTATCCGATGTAGCATGAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027541.2-935s1c1
Sequence:CCGGCGACAAATCGAGGAACGGAAACTCGAGTTTCCGTTCCTCGATTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027541.4-2537s21c1
Sequence:CCGGACTACTGTTAGCCCTTGTATCCTCGAGGATACAAGGGCTAACAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027541.4-2271s21c1
Sequence:CCGGTCTCATGCTACATCGGATAAACTCGAGTTTATCCGATGTAGCATGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027541.4-1469s21c1
Sequence:CCGGTCCATGACAAGGGCAAATTTGCTCGAGCAAATTTGCCCTTGTCATGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027541.4-2116s21c1
Sequence:CCGGGTGTATAGAGTTCGAAATTTGCTCGAGCAAATTTCGAACTCTATACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000328848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027541.4-1507s21c1
Sequence:CCGGTTACGGACAAAGGCTCAATTGCTCGAGCAATTGAGCCTTTGTCCGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027541
VALIDATED
PRPF3 MISSION shRNA Lentiviral Transduction Particles
pre-mRNA processing factor 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027541.2-2550s1c1
Sequence:CCGGCCTTGTATCTTCTTTGCCTTTCTCGAGAAAGGCAAAGAAGATACAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027541.2-749s1c1
Sequence:CCGGCGAGAGTTAAAGGAGGTGTTTCTCGAGAAACACCTCCTTTAACTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027541.2-1903s1c1
Sequence:CCGGGCCCAAAGTGAGAATCTCAAACTCGAGTTTGAGATTCTCACTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027541.2-2270s1c1
Sequence:CCGGCGTCTCATGCTACATCGGATACTCGAGTATCCGATGTAGCATGAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_027541.2-935s1c1
Sequence:CCGGCGACAAATCGAGGAACGGAAACTCGAGTTTCCGTTCCTCGATTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328844    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027541.4-2537s21c1
Sequence:CCGGACTACTGTTAGCCCTTGTATCCTCGAGGATACAAGGGCTAACAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_027541.4-2271s21c1
Sequence:CCGGTCTCATGCTACATCGGATAAACTCGAGTTTATCCGATGTAGCATGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328789    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027541.4-1469s21c1
Sequence:CCGGTCCATGACAAGGGCAAATTTGCTCGAGCAAATTTGCCCTTGTCATGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027541.4-2116s21c1
Sequence:CCGGGTGTATAGAGTTCGAAATTTGCTCGAGCAAATTTCGAACTCTATACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000328848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027541.4-1507s21c1
Sequence:CCGGTTACGGACAAAGGCTCAATTGCTCGAGCAATTGAGCCTTTGTCCGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)