EMAIL THIS PAGE TO A FRIEND

PRPF40A

PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)

120 Gene Product Result for
Synonyms: FBP-11 FBP11 FLAF1 FNBP3 HIP-10 HIP10 HYPA NY-REN-6 Prp40
Gene ID:
Mouse(56194) PRP40 pre-mRNA processing factor 40 homolog A (yeast)
Rat(295607) PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
cow(100301114) PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
sheep(101116380) PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
domestic guinea pig(100722588) PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
naked mole-rat(101718799) PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
Zebrafish(321555) PRP40 pre-mRNA processing factor 40 homolog A (yeast)
Horse(100058054) PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
domestic cat(101081657) PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
chicken(373972) PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
dog(476152) PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018785 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018785 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018785 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017892 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017892 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017892 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082041 MISSION® esiRNA esiRNA human PRPF40A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017892 Rosetta Predictions human pricing
XM_371575 Rosetta Predictions human pricing
XM_931099 Rosetta Predictions human pricing
NM_001106480 Rosetta Predictions rat pricing
NM_018785 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017892 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00350855 predicted 1836
2 SASI_Hs02_00350856 predicted 1518
3 SASI_Hs02_00350857 predicted 2036
4 SASI_Hs02_00350858 predicted 1984
5 SASI_Hs02_00350859 predicted 1865
6 SASI_Hs02_00350860 predicted 1589
7 SASI_Hs02_00350861 predicted 2281
8 SASI_Hs02_00350862 predicted 2270
9 SASI_Hs02_00350863 predicted 362
10 SASI_Hs02_00350864 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371575 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00267121 predicted 826
2 SASI_Hs01_00267122 predicted 818
3 SASI_Hs01_00267123 predicted 822
4 SASI_Hs01_00267124 predicted 286
5 SASI_Hs01_00267125 predicted 299
6 SASI_Hs01_00267126 predicted 487
7 SASI_Hs01_00267127 predicted 431
8 SASI_Hs01_00267128 predicted 310
9 SASI_Hs01_00267129 predicted 32
10 SASI_Hs01_00267130 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_931099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00283489 predicted 2054
2 SASI_Hs01_00283490 predicted 2058
3 SASI_Hs01_00283491 predicted 2080
4 SASI_Hs01_00283492 predicted 2056
5 SASI_Hs01_00283493 predicted 1525
6 SASI_Hs01_00283494 predicted 1535
7 SASI_Hs01_00283495 predicted 1725
8 SASI_Hs01_00283496 predicted 2388
9 SASI_Hs01_00283497 predicted 1674
10 SASI_Hs01_00283498 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00219378 predicted 380
2 SASI_Rn02_00219379 predicted 2031
3 SASI_Rn02_00219380 predicted 737
4 SASI_Rn02_00219381 predicted 250
5 SASI_Rn02_00219382 predicted 463
6 SASI_Rn02_00219383 predicted 448
7 SASI_Rn02_00219384 predicted 583
8 SASI_Rn02_00219385 predicted 2322
9 SASI_Rn02_00219386 predicted 622
10 SASI_Rn02_00219387 predicted 2448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018785 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090099 predicted 2034
2 SASI_Mm01_00090100 predicted 2295
3 SASI_Mm02_00324098 predicted 2893
4 SASI_Mm01_00090101 predicted 448
5 SASI_Mm01_00090103 predicted 2048
6 SASI_Mm01_00090104 predicted 2324
7 SASI_Mm01_00090105 predicted 588
8 SASI_Mm01_00090106 predicted 2771
9 SASI_Mm01_00090107 predicted 430
10 SASI_Mm01_00090108 predicted 2373
11 SASI_Mm01_00090102 predicted 2759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018785
PRPF40A MISSION shRNA Bacterial Glycerol Stock
PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018785.1-3054s1c1
Sequence:CCGGCCTATGGTAATAACTGTCTTTCTCGAGAAAGACAGTTATTACCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-1011s1c1
Sequence:CCGGGCTTGCTAATACCACAGCTATCTCGAGATAGCTGTGGTATTAGCAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-1910s1c1
Sequence:CCGGGCTCTGACATTCGCTTCACTACTCGAGTAGTGAAGCGAATGTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-771s1c1
Sequence:CCGGCCCAGTTCCTACAACAGAAATCTCGAGATTTCTGTTGTAGGAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-532s1c1
Sequence:CCGGGCTGAGCAACTATTGTCTAAACTCGAGTTTAGACAATAGTTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018785.2-532s21c1
Sequence:CCGGGCTGAGCAACTATTGTCTAAACTCGAGTTTAGACAATAGTTGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018785.2-1910s21c1
Sequence:CCGGGCTCTGACATTCGCTTCACTACTCGAGTAGTGAAGCGAATGTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018785.2-3054s21c1
Sequence:CCGGCCTATGGTAATAACTGTCTTTCTCGAGAAAGACAGTTATTACCATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018785.2-771s21c1
Sequence:CCGGCCCAGTTCCTACAACAGAAATCTCGAGATTTCTGTTGTAGGAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018785
PRPF40A MISSION shRNA shRNA Plasmid DNA
PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018785.1-3054s1c1
Sequence:CCGGCCTATGGTAATAACTGTCTTTCTCGAGAAAGACAGTTATTACCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-1011s1c1
Sequence:CCGGGCTTGCTAATACCACAGCTATCTCGAGATAGCTGTGGTATTAGCAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-1910s1c1
Sequence:CCGGGCTCTGACATTCGCTTCACTACTCGAGTAGTGAAGCGAATGTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-771s1c1
Sequence:CCGGCCCAGTTCCTACAACAGAAATCTCGAGATTTCTGTTGTAGGAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-532s1c1
Sequence:CCGGGCTGAGCAACTATTGTCTAAACTCGAGTTTAGACAATAGTTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018785.2-532s21c1
Sequence:CCGGGCTGAGCAACTATTGTCTAAACTCGAGTTTAGACAATAGTTGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018785.2-1910s21c1
Sequence:CCGGGCTCTGACATTCGCTTCACTACTCGAGTAGTGAAGCGAATGTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018785.2-3054s21c1
Sequence:CCGGCCTATGGTAATAACTGTCTTTCTCGAGAAAGACAGTTATTACCATAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018785.2-771s21c1
Sequence:CCGGCCCAGTTCCTACAACAGAAATCTCGAGATTTCTGTTGTAGGAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018785
PRPF40A MISSION shRNA Lentiviral Transduction Particles
PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123459    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018785.1-3054s1c1
Sequence:CCGGCCTATGGTAATAACTGTCTTTCTCGAGAAAGACAGTTATTACCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-1011s1c1
Sequence:CCGGGCTTGCTAATACCACAGCTATCTCGAGATAGCTGTGGTATTAGCAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-1910s1c1
Sequence:CCGGGCTCTGACATTCGCTTCACTACTCGAGTAGTGAAGCGAATGTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-771s1c1
Sequence:CCGGCCCAGTTCCTACAACAGAAATCTCGAGATTTCTGTTGTAGGAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018785.1-532s1c1
Sequence:CCGGGCTGAGCAACTATTGTCTAAACTCGAGTTTAGACAATAGTTGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316926    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018785.2-532s21c1
Sequence:CCGGGCTGAGCAACTATTGTCTAAACTCGAGTTTAGACAATAGTTGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018785.2-1910s21c1
Sequence:CCGGGCTCTGACATTCGCTTCACTACTCGAGTAGTGAAGCGAATGTCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316925    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018785.2-3054s21c1
Sequence:CCGGCCTATGGTAATAACTGTCTTTCTCGAGAAAGACAGTTATTACCATAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018785.2-771s21c1
Sequence:CCGGCCCAGTTCCTACAACAGAAATCTCGAGATTTCTGTTGTAGGAACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017892
VALIDATED
PRPF40A MISSION shRNA Bacterial Glycerol Stock
PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017892.3-151s21c1
Sequence:CCGGTATGGGTCAGAGAGCGAATATCTCGAGATATTCGCTCTCTGACCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017892.3-2042s21c1
Sequence:CCGGGCGATAATCAGTTCAACTAAACTCGAGTTTAGTTGAACTGATTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017892.3-244s21c1
Sequence:CCGGTGGAATGATGTCGTCAGTAATCTCGAGATTACTGACGACATCATTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017892.3-1256s21c1
Sequence:CCGGCAAGCCTTTAATGCCTATAAACTCGAGTTTATAGGCATTAAAGGCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017892.3-6407s21c1
Sequence:CCGGTCCTCGGTGGCAGGGATTTATCTCGAGATAAATCCCTGCCACCGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017892
VALIDATED
PRPF40A MISSION shRNA shRNA Plasmid DNA
PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017892.3-151s21c1
Sequence:CCGGTATGGGTCAGAGAGCGAATATCTCGAGATATTCGCTCTCTGACCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017892.3-2042s21c1
Sequence:CCGGGCGATAATCAGTTCAACTAAACTCGAGTTTAGTTGAACTGATTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017892.3-244s21c1
Sequence:CCGGTGGAATGATGTCGTCAGTAATCTCGAGATTACTGACGACATCATTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017892.3-1256s21c1
Sequence:CCGGCAAGCCTTTAATGCCTATAAACTCGAGTTTATAGGCATTAAAGGCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017892.3-6407s21c1
Sequence:CCGGTCCTCGGTGGCAGGGATTTATCTCGAGATAAATCCCTGCCACCGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017892
VALIDATED
PRPF40A MISSION shRNA Lentiviral Transduction Particles
PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017892.3-151s21c1
Sequence:CCGGTATGGGTCAGAGAGCGAATATCTCGAGATATTCGCTCTCTGACCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_017892.3-2042s21c1
Sequence:CCGGGCGATAATCAGTTCAACTAAACTCGAGTTTAGTTGAACTGATTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_017892.3-244s21c1
Sequence:CCGGTGGAATGATGTCGTCAGTAATCTCGAGATTACTGACGACATCATTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017892.3-1256s21c1
Sequence:CCGGCAAGCCTTTAATGCCTATAAACTCGAGTTTATAGGCATTAAAGGCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017892.3-6407s21c1
Sequence:CCGGTCCTCGGTGGCAGGGATTTATCTCGAGATAAATCCCTGCCACCGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)