EMAIL THIS PAGE TO A FRIEND

PRPF40B

PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)

60 Gene Product Result for
Synonyms: HYPC
Gene ID:
Human(25766) Summary: This gene encodes a WW-domain containing protein similar to yeast splicing factor PRP40. This protein has been shown to interact with Huntingtin and MeCP2. Alternative splicing results in different transcriptional variants. [provided by RefSeq, Jun 2012]
Mouse(54614) PRP40 pre-mRNA processing factor 40 homolog B (yeast)
Rat(363000) PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
domestic cat(101092446) PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
dog(477615) PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
naked mole-rat(101711870) PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
domestic guinea pig(100724228) PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
cow(513782) PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
sheep(101117921) PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012272 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012272 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012272 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_018786 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018786 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018786 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001031698 Rosetta Predictions human pricing
NM_012272 Rosetta Predictions human pricing
NM_001134583 Rosetta Predictions rat pricing
NM_018786 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031698 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046489 predicted 2431
2 SASI_Hs01_00046490 predicted 1000
3 SASI_Hs01_00046491 predicted 547
4 SASI_Hs01_00046493 predicted 983
5 SASI_Hs02_00307715 predicted 1386
6 SASI_Hs01_00046494 predicted 1319
7 SASI_Hs01_00046495 predicted 496
8 SASI_Hs01_00046496 predicted 1429
9 SASI_Hs02_00307716 predicted 1532
10 SASI_Hs01_00046497 predicted 728
11 SASI_Hs01_00046488 predicted 573
12 SASI_Hs01_00046492 predicted 1299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167206 predicted 2883
2 SASI_Hs01_00167207 predicted 1471
3 SASI_Hs01_00167208 predicted 1024
4 SASI_Hs01_00167210 predicted 1451
5 SASI_Hs02_00343995 predicted 1860
6 SASI_Hs01_00167211 predicted 1788
7 SASI_Hs01_00167212 predicted 963
8 SASI_Hs01_00167213 predicted 1900
9 SASI_Hs02_00343996 predicted 2003
10 SASI_Hs01_00167214 predicted 1198
11 SASI_Hs01_00167205 predicted 1043
12 SASI_Hs01_00167209 predicted 1766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257309 predicted 394
2 SASI_Rn02_00257310 predicted 497
3 SASI_Rn02_00257311 predicted 386
4 SASI_Rn02_00257312 predicted 1534
5 SASI_Rn02_00257313 predicted 988
6 SASI_Rn02_00257314 predicted 393
7 SASI_Rn02_00257315 predicted 229
8 SASI_Rn02_00257316 predicted 1944
9 SASI_Rn02_00257317 predicted 1854
10 SASI_Rn02_00257318 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018786 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324099 predicted 1546
2 SASI_Mm01_00177031 predicted 247
3 SASI_Mm01_00177032 predicted 1753
4 SASI_Mm01_00177033 predicted 366
5 SASI_Mm01_00177034 predicted 1698
6 SASI_Mm01_00177036 predicted 1831
7 SASI_Mm01_00177037 predicted 1959
8 SASI_Mm01_00177038 predicted 403
9 SASI_Mm01_00177039 predicted 1871
10 SASI_Mm01_00177040 predicted 1460
11 SASI_Mm01_00177035 predicted 1244
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012272
PRPF40B MISSION shRNA Bacterial Glycerol Stock
PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012272.1-2251s21c1
Sequence:CCGGAGGACTTCGCCCACGTCATAACTCGAGTTATGACGTGGGCGAAGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012272.1-1993s21c1
Sequence:CCGGGACGCCAACAACGCAAGAATCCTCGAGGATTCTTGCGTTGTTGGCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012272.1-850s21c1
Sequence:CCGGGGCGCATCTACTACTACAATGCTCGAGCATTGTAGTAGTAGATGCGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-2153s1c1
Sequence:CCGGTCTGGACTTATTCAAGTTCTACTCGAGTAGAACTTGAATAAGTCCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012272.1-3345s1c1
Sequence:CCGGAGACCAGAGATGGGTGGTATACTCGAGTATACCACCCATCTCTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-1041s1c1
Sequence:CCGGCTAGAGGTTCTAGTCAAACAACTCGAGTTGTTTGACTAGAACCTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-2154s1c1
Sequence:CCGGCTGGACTTATTCAAGTTCTATCTCGAGATAGAACTTGAATAAGTCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-1496s1c1
Sequence:CCGGGCAGGCATTCAATGCCTACAACTCGAGTTGTAGGCATTGAATGCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012272
PRPF40B MISSION shRNA shRNA Plasmid DNA
PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012272.1-2251s21c1
Sequence:CCGGAGGACTTCGCCCACGTCATAACTCGAGTTATGACGTGGGCGAAGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012272.1-1993s21c1
Sequence:CCGGGACGCCAACAACGCAAGAATCCTCGAGGATTCTTGCGTTGTTGGCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012272.1-850s21c1
Sequence:CCGGGGCGCATCTACTACTACAATGCTCGAGCATTGTAGTAGTAGATGCGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-2153s1c1
Sequence:CCGGTCTGGACTTATTCAAGTTCTACTCGAGTAGAACTTGAATAAGTCCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012272.1-3345s1c1
Sequence:CCGGAGACCAGAGATGGGTGGTATACTCGAGTATACCACCCATCTCTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-1041s1c1
Sequence:CCGGCTAGAGGTTCTAGTCAAACAACTCGAGTTGTTTGACTAGAACCTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-2154s1c1
Sequence:CCGGCTGGACTTATTCAAGTTCTATCTCGAGATAGAACTTGAATAAGTCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-1496s1c1
Sequence:CCGGGCAGGCATTCAATGCCTACAACTCGAGTTGTAGGCATTGAATGCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012272
PRPF40B MISSION shRNA Lentiviral Transduction Particles
PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012272.1-2251s21c1
Sequence:CCGGAGGACTTCGCCCACGTCATAACTCGAGTTATGACGTGGGCGAAGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428719    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012272.1-1993s21c1
Sequence:CCGGGACGCCAACAACGCAAGAATCCTCGAGGATTCTTGCGTTGTTGGCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433082    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012272.1-850s21c1
Sequence:CCGGGGCGCATCTACTACTACAATGCTCGAGCATTGTAGTAGTAGATGCGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-2153s1c1
Sequence:CCGGTCTGGACTTATTCAAGTTCTACTCGAGTAGAACTTGAATAAGTCCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075153    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012272.1-3345s1c1
Sequence:CCGGAGACCAGAGATGGGTGGTATACTCGAGTATACCACCCATCTCTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-1041s1c1
Sequence:CCGGCTAGAGGTTCTAGTCAAACAACTCGAGTTGTTTGACTAGAACCTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-2154s1c1
Sequence:CCGGCTGGACTTATTCAAGTTCTATCTCGAGATAGAACTTGAATAAGTCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012272.1-1496s1c1
Sequence:CCGGGCAGGCATTCAATGCCTACAACTCGAGTTGTAGGCATTGAATGCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018786
PRPF40B MISSION shRNA Bacterial Glycerol Stock
PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000123449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018786.1-2714s1c1
Sequence:CCGGGCTACTTTCTGCCTTGGACTTCTCGAGAAGTCCAAGGCAGAAAGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018786.1-1025s1c1
Sequence:CCGGGCCCAAACTAAGTGAGAAGAACTCGAGTTCTTCTCACTTAGTTTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018786.1-1751s1c1
Sequence:CCGGCGATGAGAAGAAGATCATAAACTCGAGTTTATGATCTTCTTCTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018786.1-2332s1c1
Sequence:CCGGCCTCACTTGATTCAGTTGAAACTCGAGTTTCAACTGAATCAAGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018786
PRPF40B MISSION shRNA shRNA Plasmid DNA
PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000123449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018786.1-2714s1c1
Sequence:CCGGGCTACTTTCTGCCTTGGACTTCTCGAGAAGTCCAAGGCAGAAAGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018786.1-1025s1c1
Sequence:CCGGGCCCAAACTAAGTGAGAAGAACTCGAGTTCTTCTCACTTAGTTTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018786.1-1751s1c1
Sequence:CCGGCGATGAGAAGAAGATCATAAACTCGAGTTTATGATCTTCTTCTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000123450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018786.1-2332s1c1
Sequence:CCGGCCTCACTTGATTCAGTTGAAACTCGAGTTTCAACTGAATCAAGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018786
PRPF40B MISSION shRNA Lentiviral Transduction Particles
PRP40 pre-mRNA processing factor 40 homolog B (S. cerevisiae)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000123449    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018786.1-2714s1c1
Sequence:CCGGGCTACTTTCTGCCTTGGACTTCTCGAGAAGTCCAAGGCAGAAAGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018786.1-1025s1c1
Sequence:CCGGGCCCAAACTAAGTGAGAAGAACTCGAGTTCTTCTCACTTAGTTTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018786.1-1751s1c1
Sequence:CCGGCGATGAGAAGAAGATCATAAACTCGAGTTTATGATCTTCTTCTCATCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000123450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018786.1-2332s1c1
Sequence:CCGGCCTCACTTGATTCAGTTGAAACTCGAGTTTCAACTGAATCAAGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)