EMAIL THIS PAGE TO A FRIEND

PRPF4

PRP4 pre-mRNA processing factor 4 homolog (yeast)

56 Gene Product Result for
Synonyms: HPRP4 HPRP4P PRP4 Prp4p SNRNP60
UniProtKB ID: O43172, O43445, O43864, Q5T1M8, Q96DG2, Q96IK4
Gene ID:
Human(9128) Summary: The protein encoded by this gene is part of a heteromeric complex that binds U4, U5, and U6 small nuclear RNAs and is involved in pre-mRNA splicing. The encoded protein also is a mitotic checkpoint protein and a regulator of chemoresistance in human ovarian cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Mouse(70052) PRP4 pre-mRNA processing factor 4 homolog (yeast)
Rat(298095) PRP4 pre-mRNA processing factor 4 homolog (yeast)
Zebrafish(326944) PRP4 pre-mRNA processing factor 4 homolog (yeast)
chicken(417270) PRP4 pre-mRNA processing factor 4 homolog (yeast)
dog(474807) PRP4 pre-mRNA processing factor 4 homolog (yeast)
Horse(100050303) PRP4 pre-mRNA processing factor 4 homolog (yeast)
domestic cat(101095927) PRP4 pre-mRNA processing factor 4 homolog (yeast)
naked mole-rat(101704811) PRP4 pre-mRNA processing factor 4 homolog (yeast)
domestic guinea pig(100733009) PRP4 pre-mRNA processing factor 4 homolog (yeast)
cow(508735) PRP4 pre-mRNA processing factor 4 homolog (yeast)
sheep(101107843) PRP4 pre-mRNA processing factor 4 homolog (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004697 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004697 Rosetta Predictions human pricing
NM_001106659 Rosetta Predictions rat pricing
NM_027297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062207 predicted 756
2 SASI_Hs01_00062208 predicted 737
3 SASI_Hs01_00062209 predicted 1452
4 SASI_Hs02_00338144 predicted 1237
5 SASI_Hs02_00338145 predicted 1402
6 SASI_Hs01_00062211 predicted 1424
7 SASI_Hs01_00062212 predicted 448
8 SASI_Hs01_00062214 predicted 1528
9 SASI_Hs02_00338146 predicted 578
10 SASI_Hs02_00338147 predicted 1433
11 SASI_Hs01_00062205 predicted 879
12 SASI_Hs01_00062206 predicted 988
13 SASI_Hs01_00062210 predicted 542
14 SASI_Hs01_00062213 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106659 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221128 predicted 1704
2 SASI_Rn02_00221129 predicted 197
3 SASI_Rn02_00221130 predicted 748
4 SASI_Rn02_00221131 predicted 1424
5 SASI_Rn02_00221132 predicted 231
6 SASI_Rn02_00221133 predicted 238
7 SASI_Rn02_00221134 predicted 1126
8 SASI_Rn02_00221135 predicted 1296
9 SASI_Rn02_00221136 predicted 1594
10 SASI_Rn02_00221137 predicted 1545
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106679 predicted 1444
2 SASI_Mm01_00106680 predicted 1304
3 SASI_Mm01_00106681 predicted 918
4 SASI_Mm01_00106682 predicted 1185
5 SASI_Mm01_00106683 predicted 219
6 SASI_Mm01_00106684 predicted 1435
7 SASI_Mm01_00106685 predicted 619
8 SASI_Mm02_00331907 predicted 474
9 SASI_Mm01_00106686 predicted 1490
10 SASI_Mm01_00106687 predicted 1017
11 SASI_Mm01_00106678 predicted 1679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004697
VALIDATED
PRPF4 MISSION shRNA Bacterial Glycerol Stock
PRP4 pre-mRNA processing factor 4 homolog (yeast)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-693s21c1
Sequence:CCGGCACAAGTCTCTCCGGTCTTTGCTCGAGCAAAGACCGGAGAGACTTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-1078s21c1
Sequence:CCGGATGACCGTTCATGGCGCTTATCTCGAGATAAGCGCCATGAACGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-1230s21c1
Sequence:CCGGCTACGCACAGGACGTTGTATCCTCGAGGATACAACGTCCTGTGCGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-582s21c1
Sequence:CCGGAGACTATGGATTGCTAATTATCTCGAGATAATTAGCAATCCATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004697.3-1528s1c1
Sequence:CCGGGCAAAGTGATGGGCCTAGATACTCGAGTATCTAGGCCCATCACTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004697.3-1242s1c1
Sequence:CCGGCGTTGTATCATGTTCTTAGAACTCGAGTTCTAAGAACATGATACAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004697.3-1650s1c1
Sequence:CCGGGCTCTCTCTAAGGAGCTGTTTCTCGAGAAACAGCTCCTTAGAGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004697.3-747s1c1
Sequence:CCGGCCTATCTCCTACTGTCACTTTCTCGAGAAAGTGACAGTAGGAGATAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004697.3-1238s1c1
Sequence:CCGGAGGACGTTGTATCATGTTCTTCTCGAGAAGAACATGATACAACGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-226s21c1
Sequence:CCGGGGATCGAAGCTGGAAATATTACTCGAGTAATATTTCCAGCTTCGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004697.3-1849s21c1
Sequence:CCGGCCACGAACTGTGTAGACATTGCTCGAGCAATGTCTACACAGTTCGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-988s21c1
Sequence:CCGGATGAACCAGTGGCAGATATTGCTCGAGCAATATCTGCCACTGGTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004697
VALIDATED
PRPF4 MISSION shRNA shRNA Plasmid DNA
PRP4 pre-mRNA processing factor 4 homolog (yeast)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-693s21c1
Sequence:CCGGCACAAGTCTCTCCGGTCTTTGCTCGAGCAAAGACCGGAGAGACTTGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000364756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-1078s21c1
Sequence:CCGGATGACCGTTCATGGCGCTTATCTCGAGATAAGCGCCATGAACGGTCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000364754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-1230s21c1
Sequence:CCGGCTACGCACAGGACGTTGTATCCTCGAGGATACAACGTCCTGTGCGTAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000364701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-582s21c1
Sequence:CCGGAGACTATGGATTGCTAATTATCTCGAGATAATTAGCAATCCATAGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000074772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004697.3-1528s1c1
Sequence:CCGGGCAAAGTGATGGGCCTAGATACTCGAGTATCTAGGCCCATCACTTTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000074769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004697.3-1242s1c1
Sequence:CCGGCGTTGTATCATGTTCTTAGAACTCGAGTTCTAAGAACATGATACAACGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000074768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004697.3-1650s1c1
Sequence:CCGGGCTCTCTCTAAGGAGCTGTTTCTCGAGAAACAGCTCCTTAGAGAGAGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000074770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004697.3-747s1c1
Sequence:CCGGCCTATCTCCTACTGTCACTTTCTCGAGAAAGTGACAGTAGGAGATAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000074771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004697.3-1238s1c1
Sequence:CCGGAGGACGTTGTATCATGTTCTTCTCGAGAAGAACATGATACAACGTCCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000369441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-226s21c1
Sequence:CCGGGGATCGAAGCTGGAAATATTACTCGAGTAATATTTCCAGCTTCGATCCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000364755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004697.3-1849s21c1
Sequence:CCGGCCACGAACTGTGTAGACATTGCTCGAGCAATGTCTACACAGTTCGTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000364700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-988s21c1
Sequence:CCGGATGAACCAGTGGCAGATATTGCTCGAGCAATATCTGCCACTGGTTCATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004697
VALIDATED
PRPF4 MISSION shRNA Lentiviral Transduction Particles
PRP4 pre-mRNA processing factor 4 homolog (yeast)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-693s21c1
Sequence:CCGGCACAAGTCTCTCCGGTCTTTGCTCGAGCAAAGACCGGAGAGACTTGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-1078s21c1
Sequence:CCGGATGACCGTTCATGGCGCTTATCTCGAGATAAGCGCCATGAACGGTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-1230s21c1
Sequence:CCGGCTACGCACAGGACGTTGTATCCTCGAGGATACAACGTCCTGTGCGTAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-582s21c1
Sequence:CCGGAGACTATGGATTGCTAATTATCTCGAGATAATTAGCAATCCATAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004697.3-1528s1c1
Sequence:CCGGGCAAAGTGATGGGCCTAGATACTCGAGTATCTAGGCCCATCACTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004697.3-1242s1c1
Sequence:CCGGCGTTGTATCATGTTCTTAGAACTCGAGTTCTAAGAACATGATACAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004697.3-1650s1c1
Sequence:CCGGGCTCTCTCTAAGGAGCTGTTTCTCGAGAAACAGCTCCTTAGAGAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004697.3-747s1c1
Sequence:CCGGCCTATCTCCTACTGTCACTTTCTCGAGAAAGTGACAGTAGGAGATAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004697.3-1238s1c1
Sequence:CCGGAGGACGTTGTATCATGTTCTTCTCGAGAAGAACATGATACAACGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369441    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-226s21c1
Sequence:CCGGGGATCGAAGCTGGAAATATTACTCGAGTAATATTTCCAGCTTCGATCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004697.3-1849s21c1
Sequence:CCGGCCACGAACTGTGTAGACATTGCTCGAGCAATGTCTACACAGTTCGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004697.3-988s21c1
Sequence:CCGGATGAACCAGTGGCAGATATTGCTCGAGCAATATCTGCCACTGGTTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027297
VALIDATED
PRPF4 MISSION shRNA Bacterial Glycerol Stock
PRP4 pre-mRNA processing factor 4 homolog (yeast)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027297.2-2356s1c1
Sequence:CCGGCGAGAATGAAACCAGAGCCATCTCGAGATGGCTCTGGTTTCATTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027297.2-214s1c1
Sequence:CCGGCCGGCATTGAAGCAGGAAATACTCGAGTATTTCCTGCTTCAATGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027297.2-1233s1c1
Sequence:CCGGCGCTGCATTATGTTCCTGGAACTCGAGTTCCAGGAACATAATGCAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027297.2-291s1c1
Sequence:CCGGGCAGAAGTCTTGGCAGAGTTTCTCGAGAAACTCTGCCAAGACTTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027297.2-849s1c1
Sequence:CCGGCGAGGCCATAACACAAATGTACTCGAGTACATTTGTGTTATGGCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027297
VALIDATED
PRPF4 MISSION shRNA shRNA Plasmid DNA
PRP4 pre-mRNA processing factor 4 homolog (yeast)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027297.2-2356s1c1
Sequence:CCGGCGAGAATGAAACCAGAGCCATCTCGAGATGGCTCTGGTTTCATTCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027297.2-214s1c1
Sequence:CCGGCCGGCATTGAAGCAGGAAATACTCGAGTATTTCCTGCTTCAATGCCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027297.2-1233s1c1
Sequence:CCGGCGCTGCATTATGTTCCTGGAACTCGAGTTCCAGGAACATAATGCAGCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027297.2-291s1c1
Sequence:CCGGGCAGAAGTCTTGGCAGAGTTTCTCGAGAAACTCTGCCAAGACTTCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000109063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027297.2-849s1c1
Sequence:CCGGCGAGGCCATAACACAAATGTACTCGAGTACATTTGTGTTATGGCCTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027297
VALIDATED
PRPF4 MISSION shRNA Lentiviral Transduction Particles
PRP4 pre-mRNA processing factor 4 homolog (yeast)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109060    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027297.2-2356s1c1
Sequence:CCGGCGAGAATGAAACCAGAGCCATCTCGAGATGGCTCTGGTTTCATTCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109061    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027297.2-214s1c1
Sequence:CCGGCCGGCATTGAAGCAGGAAATACTCGAGTATTTCCTGCTTCAATGCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027297.2-1233s1c1
Sequence:CCGGCGCTGCATTATGTTCCTGGAACTCGAGTTCCAGGAACATAATGCAGCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027297.2-291s1c1
Sequence:CCGGGCAGAAGTCTTGGCAGAGTTTCTCGAGAAACTCTGCCAAGACTTCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027297.2-849s1c1
Sequence:CCGGCGAGGCCATAACACAAATGTACTCGAGTACATTTGTGTTATGGCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)