EMAIL THIS PAGE TO A FRIEND

PRPF4B

PRP4 pre-mRNA processing factor 4 homolog B (yeast)

259 Gene Product Result for
Synonyms: PR4H PRP4 PRP4H PRP4K dJ1013A10.1
Gene ID:
Human(8899) Summary: Pre-mRNA splicing occurs in two sequential transesterification steps, and the protein encoded by this gene is thought to be involved in pre-mRNA splicing and in signal transduction. This protein belongs to a kinase family that includes serine/arginine-rich protein-specific kinases and cyclin-dependent kinases (CDKs). This protein is regarded as a CDK-like kinase (Clk) with homology to mitogen-activated protein kinases (MAPKs). [provided by RefSeq, Jul 2008]
Mouse(19134) PRP4 pre-mRNA processing factor 4 homolog B (yeast)
Rat(291078) PRP4 pre-mRNA processing factor 4 homolog B (yeast)
cow(512236) PRP4 pre-mRNA processing factor 4 homolog B (yeast)
sheep(101109653) PRP4 pre-mRNA processing factor 4 homolog B (yeast)
domestic guinea pig(100719128) PRP4 pre-mRNA processing factor 4 homolog B (yeast)
naked mole-rat(101722994) PRP4 pre-mRNA processing factor 4 homolog B (yeast)
chicken(420879) PRP4 pre-mRNA processing factor 4 homolog B (yeast)
domestic cat(101082567) PRP4 pre-mRNA processing factor 4 homolog B (yeast)
dog(488199) PRP4 pre-mRNA processing factor 4 homolog B (yeast)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003913 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003913 Rosetta Predictions human pricing
NM_176800 Rosetta Predictions human pricing
NM_001011923 Rosetta Predictions rat pricing
XM_574012 Rosetta Predictions rat pricing
NM_013830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00140097 predicted 2404
2 SASI_Hs01_00140098 predicted 2682
3 SASI_Hs02_00336547 predicted 2130
4 SASI_Hs01_00140100 predicted 1901
5 SASI_Hs02_00336548 predicted 2481
6 SASI_Hs01_00140101 predicted 1998
7 SASI_Hs01_00140102 predicted 2624
8 SASI_Hs01_00140105 predicted 662
9 SASI_Hs02_00336549 predicted 2463
10 SASI_Hs02_00336550 predicted 2915
11 SASI_Hs01_00140099 predicted 555
12 SASI_Hs01_00140103 predicted 2814
13 SASI_Hs01_00140104 predicted 2616
14 SASI_Hs01_00140106 predicted 2552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176800 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063422 predicted 2411
2 SASI_Hs01_00063423 predicted 2682
3 SASI_Hs01_00063424 predicted 548
4 SASI_Hs01_00063425 predicted 1910
5 SASI_Hs01_00063426 predicted 2006
6 SASI_Hs01_00063427 predicted 2628
7 SASI_Hs01_00063428 predicted 2820
8 SASI_Hs01_00063429 predicted 2619
9 SASI_Hs01_00063430 predicted 661
10 SASI_Hs01_00063431 predicted 2549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088322 predicted 1171
2 SASI_Rn01_00088323 predicted 2084
3 SASI_Rn01_00088324 predicted 2352
4 SASI_Rn01_00088325 predicted 2196
5 SASI_Rn01_00088326 predicted 2650
6 SASI_Rn01_00088327 predicted 2581
7 SASI_Rn02_00199924 predicted 1841
8 SASI_Rn01_00088328 predicted 677
9 SASI_Rn01_00088329 predicted 505
10 SASI_Rn01_00088330 predicted 2565
11 SASI_Rn01_00088331 predicted 2636
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574012 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178000 predicted 1289
2 SASI_Rn01_00178001 predicted 2201
3 SASI_Rn01_00178002 predicted 2474
4 SASI_Rn01_00178003 predicted 2317
5 SASI_Rn01_00178004 predicted 2769
6 SASI_Rn01_00178005 predicted 2702
7 SASI_Rn01_00178006 predicted 789
8 SASI_Rn01_00178007 predicted 624
9 SASI_Rn01_00178008 predicted 2685
10 SASI_Rn01_00178009 predicted 2747
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109002 predicted 577
2 SASI_Mm02_00322814 predicted 2667
3 SASI_Mm02_00322815 predicted 2468
4 SASI_Mm01_00109006 predicted 2612
5 SASI_Mm01_00109007 predicted 2766
6 SASI_Mm01_00109008 predicted 2294
7 SASI_Mm01_00109009 predicted 2942
8 SASI_Mm01_00109010 predicted 2311
9 SASI_Mm02_00322816 predicted 2749
10 SASI_Mm01_00109011 predicted 1417
11 SASI_Mm01_00109003 predicted 2697
12 SASI_Mm01_00109004 predicted 1958
13 SASI_Mm01_00109005 predicted 2209
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003913
PRPF4B MISSION shRNA Bacterial Glycerol Stock
PRP4 pre-mRNA processing factor 4 homolog B (yeast)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003913.x-5387s1c1
Sequence:CCGGCCCTATCAACTGTCTTATGTACTCGAGTACATAAGACAGTTGATAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-759s1c1
Sequence:CCGGCTCAAGATCAAGCAAGGAAATCTCGAGATTTCCTTGCTTGATCTTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-1829s1c1
Sequence:CCGGGCTGCTGATGTTAAAGAGTATCTCGAGATACTCTTTAACATCAGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-1596s1c1
Sequence:CCGGGAATGAAAGTTGAGCAGGAATCTCGAGATTCCTGCTCAACTTTCATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-863s1c1
Sequence:CCGGCCTACTGATGATAAGGTTAAACTCGAGTTTAACCTTATCATCAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-707s1c1
Sequence:CCGGAGCAAGTCAAAGGAGAGGAAACTCGAGTTTCCTCTCCTTTGACTTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003913.4-626s21c1
Sequence:CCGGACTACAAAGAAACGAAGTAAACTCGAGTTTACTTCGTTTCTTTGTAGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003913.4-6593s1c1
Sequence:CCGGGCATCTTATATTCACCCTTAACTCGAGTTAAGGGTGAATATAAGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-2685s1c1
Sequence:CCGGGCTATGACTATGGTATAGATACTCGAGTATCTATACCATAGTCATAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-1685s1c1
Sequence:CCGGGAAGATGAAGAAGCCCTAATACTCGAGTATTAGGGCTTCTTCATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-2096s1c1
Sequence:CCGGACCGATGCAGAAGGCTATTATCTCGAGATAATAGCCTTCTGCATCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003913.4-2603s21c1
Sequence:CCGGGCTTCACATGTTGCGGATAATCTCGAGATTATCCGCAACATGTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003913.4-3243s21c1
Sequence:CCGGTTAACACCAAGGGTGATATTTCTCGAGAAATATCACCCTTGGTGTTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003913
PRPF4B MISSION shRNA shRNA Plasmid DNA
PRP4 pre-mRNA processing factor 4 homolog B (yeast)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003913.x-5387s1c1
Sequence:CCGGCCCTATCAACTGTCTTATGTACTCGAGTACATAAGACAGTTGATAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-759s1c1
Sequence:CCGGCTCAAGATCAAGCAAGGAAATCTCGAGATTTCCTTGCTTGATCTTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-1829s1c1
Sequence:CCGGGCTGCTGATGTTAAAGAGTATCTCGAGATACTCTTTAACATCAGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-1596s1c1
Sequence:CCGGGAATGAAAGTTGAGCAGGAATCTCGAGATTCCTGCTCAACTTTCATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-863s1c1
Sequence:CCGGCCTACTGATGATAAGGTTAAACTCGAGTTTAACCTTATCATCAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-707s1c1
Sequence:CCGGAGCAAGTCAAAGGAGAGGAAACTCGAGTTTCCTCTCCTTTGACTTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003913.4-626s21c1
Sequence:CCGGACTACAAAGAAACGAAGTAAACTCGAGTTTACTTCGTTTCTTTGTAGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003913.4-6593s1c1
Sequence:CCGGGCATCTTATATTCACCCTTAACTCGAGTTAAGGGTGAATATAAGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-2685s1c1
Sequence:CCGGGCTATGACTATGGTATAGATACTCGAGTATCTATACCATAGTCATAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-1685s1c1
Sequence:CCGGGAAGATGAAGAAGCCCTAATACTCGAGTATTAGGGCTTCTTCATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-2096s1c1
Sequence:CCGGACCGATGCAGAAGGCTATTATCTCGAGATAATAGCCTTCTGCATCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003913.4-2603s21c1
Sequence:CCGGGCTTCACATGTTGCGGATAATCTCGAGATTATCCGCAACATGTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003913.4-3243s21c1
Sequence:CCGGTTAACACCAAGGGTGATATTTCTCGAGAAATATCACCCTTGGTGTTAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003913
PRPF4B MISSION shRNA Lentiviral Transduction Particles
PRP4 pre-mRNA processing factor 4 homolog B (yeast)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000719    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003913.x-5387s1c1
Sequence:CCGGCCCTATCAACTGTCTTATGTACTCGAGTACATAAGACAGTTGATAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-759s1c1
Sequence:CCGGCTCAAGATCAAGCAAGGAAATCTCGAGATTTCCTTGCTTGATCTTGAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-1829s1c1
Sequence:CCGGGCTGCTGATGTTAAAGAGTATCTCGAGATACTCTTTAACATCAGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-1596s1c1
Sequence:CCGGGAATGAAAGTTGAGCAGGAATCTCGAGATTCCTGCTCAACTTTCATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-863s1c1
Sequence:CCGGCCTACTGATGATAAGGTTAAACTCGAGTTTAACCTTATCATCAGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.x-707s1c1
Sequence:CCGGAGCAAGTCAAAGGAGAGGAAACTCGAGTTTCCTCTCCTTTGACTTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435706    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003913.4-626s21c1
Sequence:CCGGACTACAAAGAAACGAAGTAAACTCGAGTTTACTTCGTTTCTTTGTAGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196256    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003913.4-6593s1c1
Sequence:CCGGGCATCTTATATTCACCCTTAACTCGAGTTAAGGGTGAATATAAGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-2685s1c1
Sequence:CCGGGCTATGACTATGGTATAGATACTCGAGTATCTATACCATAGTCATAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196516    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-1685s1c1
Sequence:CCGGGAAGATGAAGAAGCCCTAATACTCGAGTATTAGGGCTTCTTCATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003913.4-2096s1c1
Sequence:CCGGACCGATGCAGAAGGCTATTATCTCGAGATAATAGCCTTCTGCATCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003913.4-2603s21c1
Sequence:CCGGGCTTCACATGTTGCGGATAATCTCGAGATTATCCGCAACATGTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003913.4-3243s21c1
Sequence:CCGGTTAACACCAAGGGTGATATTTCTCGAGAAATATCACCCTTGGTGTTAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013830
VALIDATED
PRPF4B MISSION shRNA Bacterial Glycerol Stock
PRP4 pre-mRNA processing factor 4 homolog B (yeast)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000294536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013830.2-3319s21c1
Sequence:CCGGTTAACACCGAGGGTGATATTTCTCGAGAAATATCACCCTCGGTGTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013830.1-2610s1c1
Sequence:CCGGCCGGATAATATTCTGGTTAATCTCGAGATTAACCAGAATATTATCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013830.2-2204s21c1
Sequence:CCGGGTCCTAGATAAACGTTATAATCTCGAGATTATAACGTTTATCTAGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-1130s1c1
Sequence:CCGGGCCAATTAAATCACCTTCAAACTCGAGTTTGAAGGTGATTTAATTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-1947s1c1
Sequence:CCGGCGGGAGAATGTTGACACCTTTCTCGAGAAAGGTGTCAACATTCTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-513s1c1
Sequence:CCGGGCTGAGCTTGATAATGAGTTACTCGAGTAACTCATTATCAAGCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-2730s1c1
Sequence:CCGGCCGGAGATCATTATAGGTAAACTCGAGTTTACCTATAATGATCTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013830.2-411s21c1
Sequence:CCGGTTATCGAGGCTTCCGACAAAGCTCGAGCTTTGTCGGAAGCCTCGATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013830.2-2990s21c1
Sequence:CCGGACTGTCATGAGCACCATTAATCTCGAGATTAATGGTGCTCATGACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013830.2-515s21c1
Sequence:CCGGGCTGAGCTTGATAATGAGTTACTCGAGTAACTCATTATCAAGCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013830
VALIDATED
PRPF4B MISSION shRNA shRNA Plasmid DNA
PRP4 pre-mRNA processing factor 4 homolog B (yeast)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000294536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013830.2-3319s21c1
Sequence:CCGGTTAACACCGAGGGTGATATTTCTCGAGAAATATCACCCTCGGTGTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013830.1-2610s1c1
Sequence:CCGGCCGGATAATATTCTGGTTAATCTCGAGATTAACCAGAATATTATCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013830.2-2204s21c1
Sequence:CCGGGTCCTAGATAAACGTTATAATCTCGAGATTATAACGTTTATCTAGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-1130s1c1
Sequence:CCGGGCCAATTAAATCACCTTCAAACTCGAGTTTGAAGGTGATTTAATTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-1947s1c1
Sequence:CCGGCGGGAGAATGTTGACACCTTTCTCGAGAAAGGTGTCAACATTCTCCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-513s1c1
Sequence:CCGGGCTGAGCTTGATAATGAGTTACTCGAGTAACTCATTATCAAGCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-2730s1c1
Sequence:CCGGCCGGAGATCATTATAGGTAAACTCGAGTTTACCTATAATGATCTCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013830.2-411s21c1
Sequence:CCGGTTATCGAGGCTTCCGACAAAGCTCGAGCTTTGTCGGAAGCCTCGATAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013830.2-2990s21c1
Sequence:CCGGACTGTCATGAGCACCATTAATCTCGAGATTAATGGTGCTCATGACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000294603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013830.2-515s21c1
Sequence:CCGGGCTGAGCTTGATAATGAGTTACTCGAGTAACTCATTATCAAGCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013830
VALIDATED
PRPF4B MISSION shRNA Lentiviral Transduction Particles
PRP4 pre-mRNA processing factor 4 homolog B (yeast)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000294536    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013830.2-3319s21c1
Sequence:CCGGTTAACACCGAGGGTGATATTTCTCGAGAAATATCACCCTCGGTGTTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013830.1-2610s1c1
Sequence:CCGGCCGGATAATATTCTGGTTAATCTCGAGATTAACCAGAATATTATCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294535    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013830.2-2204s21c1
Sequence:CCGGGTCCTAGATAAACGTTATAATCTCGAGATTATAACGTTTATCTAGGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-1130s1c1
Sequence:CCGGGCCAATTAAATCACCTTCAAACTCGAGTTTGAAGGTGATTTAATTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-1947s1c1
Sequence:CCGGCGGGAGAATGTTGACACCTTTCTCGAGAAAGGTGTCAACATTCTCCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025362    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-513s1c1
Sequence:CCGGGCTGAGCTTGATAATGAGTTACTCGAGTAACTCATTATCAAGCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013830.1-2730s1c1
Sequence:CCGGCCGGAGATCATTATAGGTAAACTCGAGTTTACCTATAATGATCTCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013830.2-411s21c1
Sequence:CCGGTTATCGAGGCTTCCGACAAAGCTCGAGCTTTGTCGGAAGCCTCGATAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013830.2-2990s21c1
Sequence:CCGGACTGTCATGAGCACCATTAATCTCGAGATTAATGGTGCTCATGACAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000294603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013830.2-515s21c1
Sequence:CCGGGCTGAGCTTGATAATGAGTTACTCGAGTAACTCATTATCAAGCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)