EMAIL THIS PAGE TO A FRIEND

PRPF6

pre-mRNA processing factor 6

43 Gene Product Result for
Synonyms: ANT-1 ANT1 C20orf14 Prp6 SNRNP102 TOM U5-102K hPrp6
Gene ID:
Human(24148) Summary: The protein encoded by this gene appears to be involved in pre-mRNA splicing, possibly acting as a bridging factor between U5 and U4/U6 snRNPs in formation of the spliceosome. The encoded protein also can bind androgen receptor, providing a link between transcriptional activation and splicing. [provided by RefSeq, Jul 2008]
Mouse(68879) PRP6 pre-mRNA splicing factor 6 homolog (yeast)
Rat(366276) pre-mRNA processing factor 6
Zebrafish(323855) PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)
chicken(419254) PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)
dog(477289) PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)
domestic cat(101094748) PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)
naked mole-rat(101704761) pre-mRNA processing factor 6
domestic guinea pig(100727456) pre-mRNA processing factor 6
cow(534228) PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)
sheep(101108070) PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0072 AQUA Peptide AAVELEEPEDA[R] African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat pricing
AQ0106 AQUA Peptide LSQVSDSVSGQTVVDP[K] African clawed frog, chicken, cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012469 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012469 Rosetta Predictions human pricing
NM_001079766 Rosetta Predictions rat pricing
NM_133701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051907 predicted 2418
2 SASI_Hs01_00051908 predicted 1015
3 SASI_Hs01_00051909 predicted 1809
4 SASI_Hs01_00051910 predicted 1023
5 SASI_Hs01_00051911 predicted 838
6 SASI_Hs01_00051912 predicted 1658
7 SASI_Hs01_00051913 predicted 2541
8 SASI_Hs01_00051914 predicted 2762
9 SASI_Hs01_00051915 predicted 774
10 SASI_Hs01_00051916 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208129 predicted 1328
2 SASI_Rn02_00208130 predicted 786
3 SASI_Rn02_00208131 predicted 2128
4 SASI_Rn02_00208132 predicted 1133
5 SASI_Rn02_00208133 predicted 920
6 SASI_Rn02_00208134 predicted 2647
7 SASI_Rn02_00208135 predicted 781
8 SASI_Rn02_00208136 predicted 2492
9 SASI_Rn02_00208137 predicted 976
10 SASI_Rn02_00208138 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066884 predicted 2683
2 SASI_Mm01_00066885 predicted 1358
3 SASI_Mm02_00338658 predicted 1883
4 SASI_Mm01_00066887 predicted 1156
5 SASI_Mm01_00066888 predicted 826
6 SASI_Mm02_00338659 predicted 2346
7 SASI_Mm02_00338660 predicted 1717
8 SASI_Mm01_00066889 predicted 2522
9 SASI_Mm01_00066890 predicted 1284
10 SASI_Mm01_00066891 predicted 1021
11 SASI_Mm01_00066886 predicted 2014
12 SASI_Mm01_00066892 predicted 690
13 SASI_Mm01_00066893 predicted 2224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133701
VALIDATED
PRPF6 MISSION shRNA Bacterial Glycerol Stock
pre-mRNA processing factor 6
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000317564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-2639s21c1
Sequence:CCGGGCCCTGAAGAAGTGTGAACATCTCGAGATGTTCACACTTCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-1120s21c1
Sequence:CCGGAGTAGCTCGAAACCTTATTATCTCGAGATAATAAGGTTTCGAGCTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000317484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-1301s21c1
Sequence:CCGGCGAGCAAAGAAGCGTGTTCTTCTCGAGAAGAACACGCTTCTTTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-2566s1c1
Sequence:CCGGGCCCTGAAGAAGTGTGAACATCTCGAGATGTTCACACTTCTTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-616s1c1
Sequence:CCGGCCTGATAGTTTCTTTGCCAAACTCGAGTTTGGCAAAGAAACTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-1176s1c1
Sequence:CCGGCCCGCAGTCTGTTAGGATTTACTCGAGTAAATCCTAACAGACTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-1228s1c1
Sequence:CCGGCGAGCAAAGAAGCGTGTTCTTCTCGAGAAGAACACGCTTCTTTGCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000109216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-1179s1c1
Sequence:CCGGGCAGTCTGTTAGGATTTACATCTCGAGATGTAAATCCTAACAGACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000313904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-956s21c1
Sequence:CCGGGGCTACCTGACAGATCTAAATCTCGAGATTTAGATCTGTCAGGTAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-1249s21c1
Sequence:CCGGCCCGCAGTCTGTTAGGATTTACTCGAGTAAATCCTAACAGACTGCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133701
VALIDATED
PRPF6 MISSION shRNA shRNA Plasmid DNA
pre-mRNA processing factor 6
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000317564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-2639s21c1
Sequence:CCGGGCCCTGAAGAAGTGTGAACATCTCGAGATGTTCACACTTCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-1120s21c1
Sequence:CCGGAGTAGCTCGAAACCTTATTATCTCGAGATAATAAGGTTTCGAGCTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-1301s21c1
Sequence:CCGGCGAGCAAAGAAGCGTGTTCTTCTCGAGAAGAACACGCTTCTTTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-2566s1c1
Sequence:CCGGGCCCTGAAGAAGTGTGAACATCTCGAGATGTTCACACTTCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-616s1c1
Sequence:CCGGCCTGATAGTTTCTTTGCCAAACTCGAGTTTGGCAAAGAAACTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-1176s1c1
Sequence:CCGGCCCGCAGTCTGTTAGGATTTACTCGAGTAAATCCTAACAGACTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-1228s1c1
Sequence:CCGGCGAGCAAAGAAGCGTGTTCTTCTCGAGAAGAACACGCTTCTTTGCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-1179s1c1
Sequence:CCGGGCAGTCTGTTAGGATTTACATCTCGAGATGTAAATCCTAACAGACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-956s21c1
Sequence:CCGGGGCTACCTGACAGATCTAAATCTCGAGATTTAGATCTGTCAGGTAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-1249s21c1
Sequence:CCGGCCCGCAGTCTGTTAGGATTTACTCGAGTAAATCCTAACAGACTGCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133701
VALIDATED
PRPF6 MISSION shRNA Lentiviral Transduction Particles
pre-mRNA processing factor 6
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000317564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-2639s21c1
Sequence:CCGGGCCCTGAAGAAGTGTGAACATCTCGAGATGTTCACACTTCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-1120s21c1
Sequence:CCGGAGTAGCTCGAAACCTTATTATCTCGAGATAATAAGGTTTCGAGCTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000317484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-1301s21c1
Sequence:CCGGCGAGCAAAGAAGCGTGTTCTTCTCGAGAAGAACACGCTTCTTTGCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-2566s1c1
Sequence:CCGGGCCCTGAAGAAGTGTGAACATCTCGAGATGTTCACACTTCTTCAGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-616s1c1
Sequence:CCGGCCTGATAGTTTCTTTGCCAAACTCGAGTTTGGCAAAGAAACTATCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-1176s1c1
Sequence:CCGGCCCGCAGTCTGTTAGGATTTACTCGAGTAAATCCTAACAGACTGCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-1228s1c1
Sequence:CCGGCGAGCAAAGAAGCGTGTTCTTCTCGAGAAGAACACGCTTCTTTGCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000109216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133701.1-1179s1c1
Sequence:CCGGGCAGTCTGTTAGGATTTACATCTCGAGATGTAAATCCTAACAGACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000313904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-956s21c1
Sequence:CCGGGGCTACCTGACAGATCTAAATCTCGAGATTTAGATCTGTCAGGTAGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133701.2-1249s21c1
Sequence:CCGGCCCGCAGTCTGTTAGGATTTACTCGAGTAAATCCTAACAGACTGCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012469
VALIDATED
PRPF6 MISSION shRNA Bacterial Glycerol Stock
pre-mRNA processing factor 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-804s21c1
Sequence:CCGGACCCTATCCAGGTGGACTAAACTCGAGTTTAGTCCACCTGGATAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-378s21c1
Sequence:CCGGCGAGGATCTAAATGACACCAACTCGAGTTGGTGTCATTTAGATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000293597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-1545s21c1
Sequence:CCGGCATTCCTACAGACCGACATATCTCGAGATATGTCGGTCTGTAGGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000298540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-1144s21c1
Sequence:CCGGCAAGTAGCTCGGAACCTTATCCTCGAGGATAAGGTTCCGAGCTACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012469.2-352s1c1
Sequence:CCGGCGAGGATCTAAATGACACCAACTCGAGTTGGTGTCATTTAGATCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_012469.2-964s1c1
Sequence:CCGGGACGGATTTAAATTCCATGATCTCGAGATCATGGAATTTAAATCCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000286271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-1909s21c1
Sequence:CCGGGCGTACTTCGAGAAGAACCATCTCGAGATGGTTCTTCTCGAAGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012469.2-1883s1c1
Sequence:CCGGGCGTACTTCGAGAAGAACCATCTCGAGATGGTTCTTCTCGAAGTACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012469.2-354s1c1
Sequence:CCGGAGGATCTAAATGACACCAATTCTCGAGAATTGGTGTCATTTAGATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012469.2-2400s1c1
Sequence:CCGGAGGAGAAGATTGGGCAGCTTACTCGAGTAAGCTGCCCAATCTTCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012469
VALIDATED
PRPF6 MISSION shRNA shRNA Plasmid DNA
pre-mRNA processing factor 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-804s21c1
Sequence:CCGGACCCTATCCAGGTGGACTAAACTCGAGTTTAGTCCACCTGGATAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-378s21c1
Sequence:CCGGCGAGGATCTAAATGACACCAACTCGAGTTGGTGTCATTTAGATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-1545s21c1
Sequence:CCGGCATTCCTACAGACCGACATATCTCGAGATATGTCGGTCTGTAGGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-1144s21c1
Sequence:CCGGCAAGTAGCTCGGAACCTTATCCTCGAGGATAAGGTTCCGAGCTACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012469.2-352s1c1
Sequence:CCGGCGAGGATCTAAATGACACCAACTCGAGTTGGTGTCATTTAGATCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_012469.2-964s1c1
Sequence:CCGGGACGGATTTAAATTCCATGATCTCGAGATCATGGAATTTAAATCCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-1909s21c1
Sequence:CCGGGCGTACTTCGAGAAGAACCATCTCGAGATGGTTCTTCTCGAAGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012469.2-1883s1c1
Sequence:CCGGGCGTACTTCGAGAAGAACCATCTCGAGATGGTTCTTCTCGAAGTACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012469.2-354s1c1
Sequence:CCGGAGGATCTAAATGACACCAATTCTCGAGAATTGGTGTCATTTAGATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012469.2-2400s1c1
Sequence:CCGGAGGAGAAGATTGGGCAGCTTACTCGAGTAAGCTGCCCAATCTTCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012469
VALIDATED
PRPF6 MISSION shRNA Lentiviral Transduction Particles
pre-mRNA processing factor 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298539    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-804s21c1
Sequence:CCGGACCCTATCCAGGTGGACTAAACTCGAGTTTAGTCCACCTGGATAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-378s21c1
Sequence:CCGGCGAGGATCTAAATGACACCAACTCGAGTTGGTGTCATTTAGATCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000293597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-1545s21c1
Sequence:CCGGCATTCCTACAGACCGACATATCTCGAGATATGTCGGTCTGTAGGAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000298540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-1144s21c1
Sequence:CCGGCAAGTAGCTCGGAACCTTATCCTCGAGGATAAGGTTCCGAGCTACTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012469.2-352s1c1
Sequence:CCGGCGAGGATCTAAATGACACCAACTCGAGTTGGTGTCATTTAGATCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_012469.2-964s1c1
Sequence:CCGGGACGGATTTAAATTCCATGATCTCGAGATCATGGAATTTAAATCCGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000286271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_012469.3-1909s21c1
Sequence:CCGGGCGTACTTCGAGAAGAACCATCTCGAGATGGTTCTTCTCGAAGTACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_012469.2-1883s1c1
Sequence:CCGGGCGTACTTCGAGAAGAACCATCTCGAGATGGTTCTTCTCGAAGTACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012469.2-354s1c1
Sequence:CCGGAGGATCTAAATGACACCAATTCTCGAGAATTGGTGTCATTTAGATCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012469.2-2400s1c1
Sequence:CCGGAGGAGAAGATTGGGCAGCTTACTCGAGTAAGCTGCCCAATCTTCTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)