EMAIL THIS PAGE TO A FRIEND

PRPH2

peripherin 2 (retinal degeneration, slow)

55 Gene Product Result for
Synonyms: AOFMD AVMD CACD2 DS PRPH RDS RP7 TSPAN22 rd2
UniProtKB ID: P23942, Q5TFH5, Q6DK65
Gene ID:
Human(5961) Summary: The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It may function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. This protein is essential for disk morphogenesis. Defects in this gene are associated with both central and peripheral retinal degenerations. Some of the various phenotypically different disorders are autosomal dominant retinitis pigmentosa, progressive macular degeneration, macular dystrophy and retinitis pigmentosa digenic. [provided by RefSeq, Jul 2008]
Mouse(19133) peripherin 2
Rat(25534) peripherin 2
chicken(395899) peripherin 2 (retinal degeneration, slow)
dog(403972) peripherin 2 (retinal degeneration, slow)
domestic cat(727697) peripherin 2 (retinal degeneration, slow)
cow(280907) peripherin 2 (retinal degeneration, slow)
sheep(101109569) peripherin 2 (retinal degeneration, slow)
naked mole-rat(101702401) peripherin 2 (retinal degeneration, slow)
domestic guinea pig(100713395) peripherin 2 (retinal degeneration, slow)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008938 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008938 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008938 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000322 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU153891 MISSION® esiRNA esiRNA human PRPH2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000322 Rosetta Predictions human pricing
NM_013021 Rosetta Predictions rat pricing
NM_008938 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00302333 predicted 349
2 SASI_Hs01_00225727 predicted 368
3 SASI_Hs01_00225728 predicted 387
4 SASI_Hs01_00225729 predicted 923
5 SASI_Hs01_00225730 predicted 714
6 SASI_Hs01_00225731 predicted 1003
7 SASI_Hs01_00225732 predicted 255
8 SASI_Hs02_00302334 predicted 543
9 SASI_Hs01_00225733 predicted 644
10 SASI_Hs01_00225734 predicted 650
11 SASI_Hs01_00225725 predicted 438
12 SASI_Hs01_00225726 predicted 1308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013021 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260695 predicted 601
2 SASI_Rn01_00119513 predicted 1111
3 SASI_Rn01_00119514 predicted 1167
4 SASI_Rn01_00119515 predicted 1105
5 SASI_Rn01_00119516 predicted 664
6 SASI_Rn01_00119518 predicted 1290
7 SASI_Rn01_00119519 predicted 1302
8 SASI_Rn01_00119520 predicted 639
9 SASI_Rn02_00260696 predicted 1073
10 SASI_Rn01_00119521 predicted 647
11 SASI_Rn01_00119512 predicted 240
12 SASI_Rn01_00119517 predicted 584
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008938 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056837 predicted 602
2 SASI_Mm01_00056838 predicted 1372
3 SASI_Mm01_00056839 predicted 617
4 SASI_Mm01_00056840 predicted 1197
5 SASI_Mm01_00056841 predicted 1156
6 SASI_Mm01_00056842 predicted 1687
7 SASI_Mm01_00056843 predicted 1167
8 SASI_Mm01_00056844 predicted 1701
9 SASI_Mm01_00056845 predicted 680
10 SASI_Mm01_00056846 predicted 1391
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008938
PRPH2 MISSION shRNA Bacterial Glycerol Stock
peripherin 2 (retinal degeneration, slow)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-608s1c1
Sequence:CCGGCGGACTCAAGAATGGGATGAACTCGAGTTCATCCCATTCTTGAGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-836s1c1
Sequence:CCGGCGTCCCTTTCAGCTGCTGCAACTCGAGTTGCAGCAGCTGAAAGGGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-977s1c1
Sequence:CCGGGAATTACTACAGCAGCCTCATCTCGAGATGAGGCTGCTGTAGTAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-327s1c1
Sequence:CCGGCTGTTCTTGAAGATTGAACTTCTCGAGAAGTTCAATCTTCAAGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-743s1c1
Sequence:CCGGTCAGTGGATCAGCAATCGCTACTCGAGTAGCGATTGCTGATCCACTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008938.1-772s21c1
Sequence:GTACCGGTCTCCTCCAAGGAGGTCAAAGCTCGAGCTTTGACCTCCTTGGAGGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008938.1-1318s21c1
Sequence:GTACCGGGTCCAGCTGAAAGTCCAAATTCTCGAGAATTTGGACTTTCAGCTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008938.1-1396s21c1
Sequence:GTACCGGTCCTTAGGGCAGGTTACAAACCTCGAGGTTTGTAACCTGCCCTAAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008938.1-1163s21c1
Sequence:GTACCGGGGCCTTTCTGGAGAGCTTTAACTCGAGTTAAAGCTCTCCAGAAAGGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008938
PRPH2 MISSION shRNA shRNA Plasmid DNA
peripherin 2 (retinal degeneration, slow)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-608s1c1
Sequence:CCGGCGGACTCAAGAATGGGATGAACTCGAGTTCATCCCATTCTTGAGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-836s1c1
Sequence:CCGGCGTCCCTTTCAGCTGCTGCAACTCGAGTTGCAGCAGCTGAAAGGGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-977s1c1
Sequence:CCGGGAATTACTACAGCAGCCTCATCTCGAGATGAGGCTGCTGTAGTAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-327s1c1
Sequence:CCGGCTGTTCTTGAAGATTGAACTTCTCGAGAAGTTCAATCTTCAAGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-743s1c1
Sequence:CCGGTCAGTGGATCAGCAATCGCTACTCGAGTAGCGATTGCTGATCCACTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008938.1-772s21c1
Sequence:GTACCGGTCTCCTCCAAGGAGGTCAAAGCTCGAGCTTTGACCTCCTTGGAGGAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008938.1-1318s21c1
Sequence:GTACCGGGTCCAGCTGAAAGTCCAAATTCTCGAGAATTTGGACTTTCAGCTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008938.1-1396s21c1
Sequence:GTACCGGTCCTTAGGGCAGGTTACAAACCTCGAGGTTTGTAACCTGCCCTAAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008938.1-1163s21c1
Sequence:GTACCGGGGCCTTTCTGGAGAGCTTTAACTCGAGTTAAAGCTCTCCAGAAAGGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008938
PRPH2 MISSION shRNA Lentiviral Transduction Particles
peripherin 2 (retinal degeneration, slow)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-608s1c1
Sequence:CCGGCGGACTCAAGAATGGGATGAACTCGAGTTCATCCCATTCTTGAGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-836s1c1
Sequence:CCGGCGTCCCTTTCAGCTGCTGCAACTCGAGTTGCAGCAGCTGAAAGGGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-977s1c1
Sequence:CCGGGAATTACTACAGCAGCCTCATCTCGAGATGAGGCTGCTGTAGTAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-327s1c1
Sequence:CCGGCTGTTCTTGAAGATTGAACTTCTCGAGAAGTTCAATCTTCAAGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008938.1-743s1c1
Sequence:CCGGTCAGTGGATCAGCAATCGCTACTCGAGTAGCGATTGCTGATCCACTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381728    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008938.1-772s21c1
Sequence:GTACCGGTCTCCTCCAAGGAGGTCAAAGCTCGAGCTTTGACCTCCTTGGAGGAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008938.1-1318s21c1
Sequence:GTACCGGGTCCAGCTGAAAGTCCAAATTCTCGAGAATTTGGACTTTCAGCTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008938.1-1396s21c1
Sequence:GTACCGGTCCTTAGGGCAGGTTACAAACCTCGAGGTTTGTAACCTGCCCTAAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380206    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008938.1-1163s21c1
Sequence:GTACCGGGGCCTTTCTGGAGAGCTTTAACTCGAGTTAAAGCTCTCCAGAAAGGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000322
PRPH2 MISSION shRNA Bacterial Glycerol Stock
peripherin 2 (retinal degeneration, slow)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-918s1c1
Sequence:CCGGCACCAACAACTCAGCACACTACTCGAGTAGTGTGCTGAGTTGTTGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-820s1c1
Sequence:CCGGCGAATCAAGAGCAACGTGGATCTCGAGATCCACGTTGCTCTTGATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-357s1c1
Sequence:CCGGCCTGAAGATTGAACTCCGAAACTCGAGTTTCGGAGTTCAATCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-417s1c1
Sequence:CCGGGCCCAACTCATTGATAGGGATCTCGAGATCCCTATCAATGAGTTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000322.2-1583s1c1
Sequence:CCGGCCCATCTTTCTCACACGGATTCTCGAGAATCCGTGTGAGAAAGATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-759s21c1
Sequence:GTACCGGTGCTGCAGATCGAGTTCAAATCTCGAGATTTGAACTCGATCTGCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000322.4-1634s21c1
Sequence:CCGGCATCTTTCTCACACGGATTTACTCGAGTAAATCCGTGTGAGAAAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-1083s21c1
Sequence:CCGGGTGTCGTCACGCTCCTCATTTCTCGAGAAATGAGGAGCGTGACGACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000322.4-1450s21c1
Sequence:CCGGTCTCCCTGACGGTGGAATTTACTCGAGTAAATTCCACCGTCAGGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-1109s21c1
Sequence:CCGGTTCGAGGTGACCATTACAATTCTCGAGAATTGTAATGGTCACCTCGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-428s21c1
Sequence:GTACCGGAGGAGCGATGTGATGAATAATCTCGAGATTATTCATCACATCGCTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-462s21c1
Sequence:GTACCGGTTGTGCCCAACTCATTGATAGCTCGAGCTATCAATGAGTTGGGCACAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000322
PRPH2 MISSION shRNA shRNA Plasmid DNA
peripherin 2 (retinal degeneration, slow)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-918s1c1
Sequence:CCGGCACCAACAACTCAGCACACTACTCGAGTAGTGTGCTGAGTTGTTGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-820s1c1
Sequence:CCGGCGAATCAAGAGCAACGTGGATCTCGAGATCCACGTTGCTCTTGATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-357s1c1
Sequence:CCGGCCTGAAGATTGAACTCCGAAACTCGAGTTTCGGAGTTCAATCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-417s1c1
Sequence:CCGGGCCCAACTCATTGATAGGGATCTCGAGATCCCTATCAATGAGTTGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000322.2-1583s1c1
Sequence:CCGGCCCATCTTTCTCACACGGATTCTCGAGAATCCGTGTGAGAAAGATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-759s21c1
Sequence:GTACCGGTGCTGCAGATCGAGTTCAAATCTCGAGATTTGAACTCGATCTGCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000322.4-1634s21c1
Sequence:CCGGCATCTTTCTCACACGGATTTACTCGAGTAAATCCGTGTGAGAAAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-1083s21c1
Sequence:CCGGGTGTCGTCACGCTCCTCATTTCTCGAGAAATGAGGAGCGTGACGACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000322.4-1450s21c1
Sequence:CCGGTCTCCCTGACGGTGGAATTTACTCGAGTAAATTCCACCGTCAGGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-1109s21c1
Sequence:CCGGTTCGAGGTGACCATTACAATTCTCGAGAATTGTAATGGTCACCTCGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-428s21c1
Sequence:GTACCGGAGGAGCGATGTGATGAATAATCTCGAGATTATTCATCACATCGCTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000381144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-462s21c1
Sequence:GTACCGGTTGTGCCCAACTCATTGATAGCTCGAGCTATCAATGAGTTGGGCACAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000322
PRPH2 MISSION shRNA Lentiviral Transduction Particles
peripherin 2 (retinal degeneration, slow)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-918s1c1
Sequence:CCGGCACCAACAACTCAGCACACTACTCGAGTAGTGTGCTGAGTTGTTGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-820s1c1
Sequence:CCGGCGAATCAAGAGCAACGTGGATCTCGAGATCCACGTTGCTCTTGATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014220    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-357s1c1
Sequence:CCGGCCTGAAGATTGAACTCCGAAACTCGAGTTTCGGAGTTCAATCTTCAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000322.2-417s1c1
Sequence:CCGGGCCCAACTCATTGATAGGGATCTCGAGATCCCTATCAATGAGTTGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000322.2-1583s1c1
Sequence:CCGGCCCATCTTTCTCACACGGATTCTCGAGAATCCGTGTGAGAAAGATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-759s21c1
Sequence:GTACCGGTGCTGCAGATCGAGTTCAAATCTCGAGATTTGAACTCGATCTGCAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000322.4-1634s21c1
Sequence:CCGGCATCTTTCTCACACGGATTTACTCGAGTAAATCCGTGTGAGAAAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-1083s21c1
Sequence:CCGGGTGTCGTCACGCTCCTCATTTCTCGAGAAATGAGGAGCGTGACGACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358065    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000322.4-1450s21c1
Sequence:CCGGTCTCCCTGACGGTGGAATTTACTCGAGTAAATTCCACCGTCAGGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-1109s21c1
Sequence:CCGGTTCGAGGTGACCATTACAATTCTCGAGAATTGTAATGGTCACCTCGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-428s21c1
Sequence:GTACCGGAGGAGCGATGTGATGAATAATCTCGAGATTATTCATCACATCGCTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000381144    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000322.4-462s21c1
Sequence:GTACCGGTTGTGCCCAACTCATTGATAGCTCGAGCTATCAATGAGTTGGGCACAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)