EMAIL THIS PAGE TO A FRIEND

PRPS1

phosphoribosyl pyrophosphate synthetase 1

41 Gene Product Result for
Synonyms: ARTS CMTX5 DFN2 DFNX1 PPRibP PRS-I PRSI
UniProtKB ID: P60891, B1ALA8, D3DUX6, P09329
Gene ID:
Human(5631) Summary: This gene encodes an enzyme that catalyzes the phosphoribosylation of ribose 5-phosphate to 5-phosphoribosyl-1-pyrophosphate, which is necessary for purine metabolism and nucleotide biosynthesis. Defects in this gene are a cause of phosphoribosylpyrophosphate synthetase superactivity, Charcot-Marie-Tooth disease X-linked recessive type 5 and Arts Syndrome. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
Mouse(19139) phosphoribosyl pyrophosphate synthetase 1
Rat(29562) phosphoribosyl pyrophosphate synthetase 1
domestic guinea pig(100725562) phosphoribosyl pyrophosphate synthetase 1
naked mole-rat(101725109) phosphoribosyl pyrophosphate synthetase 1
Domestic Rabbit(100355404) phosphoribosyl pyrophosphate synthetase 1
cow(781227) phosphoribosyl pyrophosphate synthetase 1
sheep(101115347) phosphoribosyl pyrophosphate synthetase 1
chicken(422185) phosphoribosyl pyrophosphate synthetase 1
domestic cat(101086044) phosphoribosyl pyrophosphate synthetase 1
dog(481011) phosphoribosyl pyrophosphate synthetase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021463 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021463 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021463 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002764 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU109761 MISSION® esiRNA esiRNA human PRPS1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002764 siRNAs that have been validated in the lab human pricing
NM_017243 Rosetta Predictions rat pricing
NM_021463 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002764 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149595 validated 1065
1 SASI_Hs01_00149596 validated 388
1 SASI_Hs01_00149594 validated 666
2 SASI_Hs01_00149597 predicted 972
3 SASI_Hs01_00149598 predicted 565
4 SASI_Hs01_00149599 predicted 395
5 SASI_Hs01_00149600 predicted 997
6 SASI_Hs01_00149601 predicted 1133
7 SASI_Hs01_00149602 predicted 883
8 SASI_Hs01_00149603 predicted 1106
9 SASI_Hs02_00334388 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017243 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00261620 predicted 1145
2 SASI_Rn01_00083185 predicted 722
3 SASI_Rn01_00083186 predicted 1061
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021463 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041684 predicted 745
2 SASI_Mm01_00041685 predicted 1070
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021463
VALIDATED
PRPS1 MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate synthetase 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021463.2-311s1c1
Sequence:CCGGGTGTGGTGAGATAAATGACAACTCGAGTTGTCATTTATCTCACCACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021463.2-899s1c1
Sequence:CCGGCCCTGCCATTTCTCGAATCAACTCGAGTTGATTCGAGAAATGGCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021463.2-419s1c1
Sequence:CCGGCCGCCAAGATAAGAAGGATAACTCGAGTTATCCTTCTTATCTTGGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021463.2-587s1c1
Sequence:CCGGCCTAAAGTGGATACGGGAGAACTCGAGTTCTCCCGTATCCACTTTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021463.2-912s1c1
Sequence:CCGGCGAATCAACAATGCATGCTTTCTCGAGAAAGCATGCATTGTTGATTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.4-994s21c1
Sequence:CCGGCAAGATACAGGTGATTGACATCTCGAGATGTCAATCACCTGTATCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021463.3-1194s21c1
Sequence:CCGGCATCTCACATTAGCTATATTACTCGAGTAATATAGCTAATGTGAGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.3-215s21c1
Sequence:CCGGGCAAGGTGGTGACTAAGAAATCTCGAGATTTCTTAGTCACCACCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021463.3-1554s21c1
Sequence:CCGGGGTAGCTCAATGCAGTAATTACTCGAGTAATTACTGCATTGAGCTACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.3-513s21c1
Sequence:CCGGGGATCTACATGCATCTCAAATCTCGAGATTTGAGATGCATGTAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.3-456s21c1
Sequence:CCGGAGCTAAGCTTGTTGCAAATATCTCGAGATATTTGCAACAAGCTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021463
VALIDATED
PRPS1 MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate synthetase 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021463.2-311s1c1
Sequence:CCGGGTGTGGTGAGATAAATGACAACTCGAGTTGTCATTTATCTCACCACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021463.2-899s1c1
Sequence:CCGGCCCTGCCATTTCTCGAATCAACTCGAGTTGATTCGAGAAATGGCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021463.2-419s1c1
Sequence:CCGGCCGCCAAGATAAGAAGGATAACTCGAGTTATCCTTCTTATCTTGGCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021463.2-587s1c1
Sequence:CCGGCCTAAAGTGGATACGGGAGAACTCGAGTTCTCCCGTATCCACTTTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021463.2-912s1c1
Sequence:CCGGCGAATCAACAATGCATGCTTTCTCGAGAAAGCATGCATTGTTGATTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.4-994s21c1
Sequence:CCGGCAAGATACAGGTGATTGACATCTCGAGATGTCAATCACCTGTATCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000365994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021463.3-1194s21c1
Sequence:CCGGCATCTCACATTAGCTATATTACTCGAGTAATATAGCTAATGTGAGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.3-215s21c1
Sequence:CCGGGCAAGGTGGTGACTAAGAAATCTCGAGATTTCTTAGTCACCACCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021463.3-1554s21c1
Sequence:CCGGGGTAGCTCAATGCAGTAATTACTCGAGTAATTACTGCATTGAGCTACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000374313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.3-513s21c1
Sequence:CCGGGGATCTACATGCATCTCAAATCTCGAGATTTGAGATGCATGTAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000366066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.3-456s21c1
Sequence:CCGGAGCTAAGCTTGTTGCAAATATCTCGAGATATTTGCAACAAGCTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021463
VALIDATED
PRPS1 MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate synthetase 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021463.2-311s1c1
Sequence:CCGGGTGTGGTGAGATAAATGACAACTCGAGTTGTCATTTATCTCACCACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021463.2-899s1c1
Sequence:CCGGCCCTGCCATTTCTCGAATCAACTCGAGTTGATTCGAGAAATGGCAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021463.2-419s1c1
Sequence:CCGGCCGCCAAGATAAGAAGGATAACTCGAGTTATCCTTCTTATCTTGGCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021463.2-587s1c1
Sequence:CCGGCCTAAAGTGGATACGGGAGAACTCGAGTTCTCCCGTATCCACTTTAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021463.2-912s1c1
Sequence:CCGGCGAATCAACAATGCATGCTTTCTCGAGAAAGCATGCATTGTTGATTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.4-994s21c1
Sequence:CCGGCAAGATACAGGTGATTGACATCTCGAGATGTCAATCACCTGTATCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000365994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021463.3-1194s21c1
Sequence:CCGGCATCTCACATTAGCTATATTACTCGAGTAATATAGCTAATGTGAGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.3-215s21c1
Sequence:CCGGGCAAGGTGGTGACTAAGAAATCTCGAGATTTCTTAGTCACCACCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374312    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021463.3-1554s21c1
Sequence:CCGGGGTAGCTCAATGCAGTAATTACTCGAGTAATTACTGCATTGAGCTACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000374313    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.3-513s21c1
Sequence:CCGGGGATCTACATGCATCTCAAATCTCGAGATTTGAGATGCATGTAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000366066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021463.3-456s21c1
Sequence:CCGGAGCTAAGCTTGTTGCAAATATCTCGAGATATTTGCAACAAGCTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002764
VALIDATED
PRPS1 MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate synthetase 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002764.x-592s1c1
Sequence:CCGGCTGCACTATTGTCTCACCTGACTCGAGTCAGGTGAGACAATAGTGCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002764.x-660s1c1
Sequence:CCGGTGGACTTTGCCTTGATTCACACTCGAGTGTGAATCAAGGCAAAGTCCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002764.x-929s1c1
Sequence:CCGGCAGGAGGACAAGATGAAGCATCTCGAGATGCTTCATCTTGTCCTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002764.x-819s1c1
Sequence:CCGGGCGCCACCAGAGTTTATGCCACTCGAGTGGCATAAACTCTGGTGGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1363s21c1
Sequence:CCGGATTCTGGCTTCCTTGATAATTCTCGAGAATTATCAAGGAAGCCAGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1124s21c1
Sequence:CCGGGAATCCGTTTCTTACCTATTCCTCGAGGAATAGGTAAGAAACGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-386s21c1
Sequence:CCGGGGCGAAATCAATGACAATTTACTCGAGTAAATTGTCATTGATTTCGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-558s21c1
Sequence:CCGGTAGCAGGTGCAGATCATATTACTCGAGTAATATGATCTGCACCTGCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1274s21c1
Sequence:CCGGACATCCCACATCAGGTATATTCTCGAGAATATACCTGATGTGGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1034s21c1
Sequence:CCGGCAGGAGGACAAGATGAAGCATCTCGAGATGCTTCATCTTGTCCTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-765s21c1
Sequence:CCGGTGGACTTTGCCTTGATTCACACTCGAGTGTGAATCAAGGCAAAGTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002764
VALIDATED
PRPS1 MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate synthetase 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002764.x-592s1c1
Sequence:CCGGCTGCACTATTGTCTCACCTGACTCGAGTCAGGTGAGACAATAGTGCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002764.x-660s1c1
Sequence:CCGGTGGACTTTGCCTTGATTCACACTCGAGTGTGAATCAAGGCAAAGTCCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002764.x-929s1c1
Sequence:CCGGCAGGAGGACAAGATGAAGCATCTCGAGATGCTTCATCTTGTCCTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002764.x-819s1c1
Sequence:CCGGGCGCCACCAGAGTTTATGCCACTCGAGTGGCATAAACTCTGGTGGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1363s21c1
Sequence:CCGGATTCTGGCTTCCTTGATAATTCTCGAGAATTATCAAGGAAGCCAGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1124s21c1
Sequence:CCGGGAATCCGTTTCTTACCTATTCCTCGAGGAATAGGTAAGAAACGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-386s21c1
Sequence:CCGGGGCGAAATCAATGACAATTTACTCGAGTAAATTGTCATTGATTTCGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-558s21c1
Sequence:CCGGTAGCAGGTGCAGATCATATTACTCGAGTAATATGATCTGCACCTGCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1274s21c1
Sequence:CCGGACATCCCACATCAGGTATATTCTCGAGAATATACCTGATGTGGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1034s21c1
Sequence:CCGGCAGGAGGACAAGATGAAGCATCTCGAGATGCTTCATCTTGTCCTCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000314705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-765s21c1
Sequence:CCGGTGGACTTTGCCTTGATTCACACTCGAGTGTGAATCAAGGCAAAGTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002764
VALIDATED
PRPS1 MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate synthetase 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002764.x-592s1c1
Sequence:CCGGCTGCACTATTGTCTCACCTGACTCGAGTCAGGTGAGACAATAGTGCAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002764.x-660s1c1
Sequence:CCGGTGGACTTTGCCTTGATTCACACTCGAGTGTGAATCAAGGCAAAGTCCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002764.x-929s1c1
Sequence:CCGGCAGGAGGACAAGATGAAGCATCTCGAGATGCTTCATCTTGTCCTCCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_002764.x-819s1c1
Sequence:CCGGGCGCCACCAGAGTTTATGCCACTCGAGTGGCATAAACTCTGGTGGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355958    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1363s21c1
Sequence:CCGGATTCTGGCTTCCTTGATAATTCTCGAGAATTATCAAGGAAGCCAGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1124s21c1
Sequence:CCGGGAATCCGTTTCTTACCTATTCCTCGAGGAATAGGTAAGAAACGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367679    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-386s21c1
Sequence:CCGGGGCGAAATCAATGACAATTTACTCGAGTAAATTGTCATTGATTTCGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-558s21c1
Sequence:CCGGTAGCAGGTGCAGATCATATTACTCGAGTAATATGATCTGCACCTGCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1274s21c1
Sequence:CCGGACATCCCACATCAGGTATATTCTCGAGAATATACCTGATGTGGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-1034s21c1
Sequence:CCGGCAGGAGGACAAGATGAAGCATCTCGAGATGCTTCATCTTGTCCTCCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000314705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_002764.3-765s21c1
Sequence:CCGGTGGACTTTGCCTTGATTCACACTCGAGTGTGAATCAAGGCAAAGTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)