EMAIL THIS PAGE TO A FRIEND

PRPS1L1

phosphoribosyl pyrophosphate synthetase 1-like 1

103 Gene Product Result for
Synonyms: PRPS1 PRPS3 PRPSL PRS-III
UniProtKB ID: P21108, Q6P5P6
Gene ID:
Human(221823) Summary: This intronless gene is specifically expressed in the testis, and encodes a protein that is highly homologous to the two subunits of phosphoribosylpyrophosphate synthetase encoded by human X-linked genes, PRPS1 and PRPS2. These enzymes convert pyrimidine, purine or pyridine bases to the corresponding ribonucleoside monophosphates. In vitro transcription/translation and site-directed mutagenesis studies indicate that translation of this mRNA initiates exclusively at a non-AUG (ACG) codon. [provided by RefSeq, Jul 2008]
Mouse(75456) phosphoribosyl pyrophosphate synthetase 1-like 1
Rat(298954) phosphoribosyl pyrophosphate synthetase 1-like 1
cow(504248) phosphoribosyl pyrophosphate synthetase 1-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029294 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029294 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029294 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175886 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU128021 MISSION® esiRNA esiRNA human PRPS1L1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175886 Rosetta Predictions human pricing
NM_001105678 Rosetta Predictions rat pricing
NM_029294 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221572 predicted 561
2 SASI_Hs01_00221573 predicted 524
3 SASI_Hs01_00221575 predicted 260
4 SASI_Hs01_00221576 predicted 423
5 SASI_Hs01_00221577 predicted 633
6 SASI_Hs01_00221578 predicted 502
7 SASI_Hs01_00221579 predicted 574
8 SASI_Hs01_00221580 predicted 684
9 SASI_Hs01_00221581 predicted 745
10 SASI_Hs02_00369161 predicted 508
11 SASI_Hs01_00221574 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105678 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211756 predicted 1072
2 SASI_Rn02_00211757 predicted 590
3 SASI_Rn02_00211758 predicted 856
4 SASI_Rn02_00211759 predicted 468
5 SASI_Rn02_00211760 predicted 1042
6 SASI_Rn02_00211761 predicted 656
7 SASI_Rn02_00211762 predicted 952
8 SASI_Rn02_00211763 predicted 270
9 SASI_Rn02_00211764 predicted 943
10 SASI_Rn02_00211765 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029294 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179861 predicted 789
2 SASI_Mm01_00179862 predicted 784
3 SASI_Mm01_00179863 predicted 857
4 SASI_Mm02_00335102 predicted 653
5 SASI_Mm01_00179865 predicted 624
6 SASI_Mm02_00335103 predicted 1121
7 SASI_Mm01_00179868 predicted 771
8 SASI_Mm02_00335104 predicted 595
9 SASI_Mm02_00335105 predicted 796
10 SASI_Mm02_00335106 predicted 887
11 SASI_Mm01_00179864 predicted 1038
12 SASI_Mm01_00179866 predicted 480
13 SASI_Mm01_00179867 predicted 1095
14 SASI_Mm01_00179869 predicted 403
15 SASI_Mm01_00179870 predicted 972
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029294
PRPS1L1 MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate synthetase 1-like 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-759s21c1
Sequence:CCGGTGAAGGATCGGGTGGCTATTCCTCGAGGAATAGCCACCCGATCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-661s21c1
Sequence:CCGGCACTTCCATCGCGGACCATTTCTCGAGAAATGGTCCGCGATGGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-1078s21c1
Sequence:CCGGCTTGTAATGCAGTGACGTAAACTCGAGTTTACGTCACTGCATTACAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-451s21c1
Sequence:CCGGTGCGAAGCTCGTAGCAAATATCTCGAGATATTTGCTACGAGCTTCGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-672s1c1
Sequence:CCGGGCGGACCATTTGAATGTGGATCTCGAGATCCACATTCAAATGGTCCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-894s1c1
Sequence:CCGGCCAGCTATTGCTCGCATCAATCTCGAGATTGATGCGAGCAATAGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-319s1c1
Sequence:CCGGACGACAGTCTAATGGAACTTTCTCGAGAAAGTTCCATTAGACTGTCGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-1036s1c1
Sequence:CCGGCCCATAACGGAGAATCTGTTTCTCGAGAAACAGATTCTCCGTTATGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-621s1c1
Sequence:CCGGTGCACGATTGTCTCTCCTGATCTCGAGATCAGGAGAGACAATCGTGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029294
PRPS1L1 MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate synthetase 1-like 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-759s21c1
Sequence:CCGGTGAAGGATCGGGTGGCTATTCCTCGAGGAATAGCCACCCGATCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-661s21c1
Sequence:CCGGCACTTCCATCGCGGACCATTTCTCGAGAAATGGTCCGCGATGGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-1078s21c1
Sequence:CCGGCTTGTAATGCAGTGACGTAAACTCGAGTTTACGTCACTGCATTACAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-451s21c1
Sequence:CCGGTGCGAAGCTCGTAGCAAATATCTCGAGATATTTGCTACGAGCTTCGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-672s1c1
Sequence:CCGGGCGGACCATTTGAATGTGGATCTCGAGATCCACATTCAAATGGTCCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-894s1c1
Sequence:CCGGCCAGCTATTGCTCGCATCAATCTCGAGATTGATGCGAGCAATAGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-319s1c1
Sequence:CCGGACGACAGTCTAATGGAACTTTCTCGAGAAAGTTCCATTAGACTGTCGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-1036s1c1
Sequence:CCGGCCCATAACGGAGAATCTGTTTCTCGAGAAACAGATTCTCCGTTATGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-621s1c1
Sequence:CCGGTGCACGATTGTCTCTCCTGATCTCGAGATCAGGAGAGACAATCGTGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029294
PRPS1L1 MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate synthetase 1-like 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-759s21c1
Sequence:CCGGTGAAGGATCGGGTGGCTATTCCTCGAGGAATAGCCACCCGATCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361939    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-661s21c1
Sequence:CCGGCACTTCCATCGCGGACCATTTCTCGAGAAATGGTCCGCGATGGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-1078s21c1
Sequence:CCGGCTTGTAATGCAGTGACGTAAACTCGAGTTTACGTCACTGCATTACAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029294.2-451s21c1
Sequence:CCGGTGCGAAGCTCGTAGCAAATATCTCGAGATATTTGCTACGAGCTTCGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-672s1c1
Sequence:CCGGGCGGACCATTTGAATGTGGATCTCGAGATCCACATTCAAATGGTCCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-894s1c1
Sequence:CCGGCCAGCTATTGCTCGCATCAATCTCGAGATTGATGCGAGCAATAGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-319s1c1
Sequence:CCGGACGACAGTCTAATGGAACTTTCTCGAGAAAGTTCCATTAGACTGTCGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-1036s1c1
Sequence:CCGGCCCATAACGGAGAATCTGTTTCTCGAGAAACAGATTCTCCGTTATGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029294.1-621s1c1
Sequence:CCGGTGCACGATTGTCTCTCCTGATCTCGAGATCAGGAGAGACAATCGTGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175886
PRPS1L1 MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate synthetase 1-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-721s21c1
Sequence:CCGGCGTGTGGCTATCCTTGTAGATCTCGAGATCTACAAGGATAGCCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-903s21c1
Sequence:CCGGCATACCTCAAGATGAGAAGATCTCGAGATCTTCTCATCTTGAGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-263s21c1
Sequence:CCGGGCGAAATCAACGACAGTCTAACTCGAGTTAGACTGTCGTTGATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-721s1c1
Sequence:CCGGCGTGTGGCTATCCTTGTAGATCTCGAGATCTACAAGGATAGCCACACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-903s1c1
Sequence:CCGGCATACCTCAAGATGAGAAGATCTCGAGATCTTCTCATCTTGAGGTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-628s1c1
Sequence:CCGGGACCAGTTGAATGTGGACTTTCTCGAGAAAGTCCACATTCAACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-574s1c1
Sequence:CCGGTGCATTATTGTCTCGCCAGATCTCGAGATCTGGCGAGACAATAATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-263s1c1
Sequence:CCGGGCGAAATCAACGACAGTCTAACTCGAGTTAGACTGTCGTTGATTTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-628s21c1
Sequence:CCGGGACCAGTTGAATGTGGACTTTCTCGAGAAAGTCCACATTCAACTGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175886
PRPS1L1 MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate synthetase 1-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-721s21c1
Sequence:CCGGCGTGTGGCTATCCTTGTAGATCTCGAGATCTACAAGGATAGCCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-903s21c1
Sequence:CCGGCATACCTCAAGATGAGAAGATCTCGAGATCTTCTCATCTTGAGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-263s21c1
Sequence:CCGGGCGAAATCAACGACAGTCTAACTCGAGTTAGACTGTCGTTGATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-721s1c1
Sequence:CCGGCGTGTGGCTATCCTTGTAGATCTCGAGATCTACAAGGATAGCCACACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-903s1c1
Sequence:CCGGCATACCTCAAGATGAGAAGATCTCGAGATCTTCTCATCTTGAGGTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-628s1c1
Sequence:CCGGGACCAGTTGAATGTGGACTTTCTCGAGAAAGTCCACATTCAACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-574s1c1
Sequence:CCGGTGCATTATTGTCTCGCCAGATCTCGAGATCTGGCGAGACAATAATGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-263s1c1
Sequence:CCGGGCGAAATCAACGACAGTCTAACTCGAGTTAGACTGTCGTTGATTTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-628s21c1
Sequence:CCGGGACCAGTTGAATGTGGACTTTCTCGAGAAAGTCCACATTCAACTGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175886
PRPS1L1 MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate synthetase 1-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333409    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-721s21c1
Sequence:CCGGCGTGTGGCTATCCTTGTAGATCTCGAGATCTACAAGGATAGCCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-903s21c1
Sequence:CCGGCATACCTCAAGATGAGAAGATCTCGAGATCTTCTCATCTTGAGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333407    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-263s21c1
Sequence:CCGGGCGAAATCAACGACAGTCTAACTCGAGTTAGACTGTCGTTGATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-721s1c1
Sequence:CCGGCGTGTGGCTATCCTTGTAGATCTCGAGATCTACAAGGATAGCCACACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-903s1c1
Sequence:CCGGCATACCTCAAGATGAGAAGATCTCGAGATCTTCTCATCTTGAGGTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-628s1c1
Sequence:CCGGGACCAGTTGAATGTGGACTTTCTCGAGAAAGTCCACATTCAACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-574s1c1
Sequence:CCGGTGCATTATTGTCTCGCCAGATCTCGAGATCTGGCGAGACAATAATGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175886.2-263s1c1
Sequence:CCGGGCGAAATCAACGACAGTCTAACTCGAGTTAGACTGTCGTTGATTTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175886.2-628s21c1
Sequence:CCGGGACCAGTTGAATGTGGACTTTCTCGAGAAAGTCCACATTCAACTGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)