EMAIL THIS PAGE TO A FRIEND

PRPSAP1

phosphoribosyl pyrophosphate synthetase-associated protein 1

66 Gene Product Result for
Synonyms: PAP39
UniProtKB ID: Q14558, B2R6M4, Q96H06
Gene ID:
Mouse(67763) phosphoribosyl pyrophosphate synthetase-associated protein 1
Rat(64390) phosphoribosyl pyrophosphate synthetase-associated protein 1
naked mole-rat(101711244) phosphoribosyl pyrophosphate synthetase-associated protein 1
domestic guinea pig(100723685) phosphoribosyl pyrophosphate synthetase-associated protein 1
cow(789409) phosphoribosyl pyrophosphate synthetase-associated protein 1
sheep(101117092) phosphoribosyl pyrophosphate synthetase-associated protein 1
cow(515538) phosphoribosyl pyrophosphate synthetase-associated protein 1
chicken(417360) phosphoribosyl pyrophosphate synthetase-associated protein 1
domestic cat(101097686) phosphoribosyl pyrophosphate synthetase-associated protein 1
dog(608323) phosphoribosyl pyrophosphate synthetase-associated protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002766 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002766 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002766 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_181343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_181343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_181343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092831 MISSION® esiRNA esiRNA human PRPSAP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002766 Rosetta Predictions human pricing
NM_022545 Rosetta Predictions rat pricing
XM_001481297 Rosetta Predictions mouse pricing
XM_181343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002766 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053188 predicted 420
2 SASI_Hs01_00053189 predicted 247
3 SASI_Hs01_00053190 predicted 751
4 SASI_Hs01_00053191 predicted 764
5 SASI_Hs01_00053192 predicted 426
6 SASI_Hs01_00053193 predicted 971
7 SASI_Hs01_00053194 predicted 534
8 SASI_Hs01_00053195 predicted 422
9 SASI_Hs01_00053196 predicted 1206
10 SASI_Hs01_00053197 predicted 995
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022545 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041477 predicted 1418
2 SASI_Rn01_00041478 predicted 703
3 SASI_Rn01_00041479 predicted 1266
4 SASI_Rn01_00041480 predicted 633
5 SASI_Rn01_00041481 predicted 794
6 SASI_Rn02_00263318 predicted 383
7 SASI_Rn01_00041483 predicted 615
8 SASI_Rn02_00263319 predicted 1404
9 SASI_Rn01_00041484 predicted 1236
10 SASI_Rn02_00263320 predicted 1220
11 SASI_Rn01_00041482 predicted 642
12 SASI_Rn01_00041485 predicted 1160
13 SASI_Rn01_00041486 predicted 1182
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00423494 predicted 735
2 SASI_Mm02_00423495 predicted 1239
3 SASI_Mm02_00423496 predicted 1402
4 SASI_Mm02_00423497 predicted 1113
5 SASI_Mm02_00423498 predicted 824
6 SASI_Mm02_00423499 predicted 862
7 SASI_Mm02_00423500 predicted 1083
8 SASI_Mm02_00423501 predicted 854
9 SASI_Mm02_00423502 predicted 1332
10 SASI_Mm02_00423503 predicted 760
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_181343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425445 predicted 897
2 SASI_Mm02_00425446 predicted 1387
3 SASI_Mm02_00425447 predicted 1551
4 SASI_Mm02_00425448 predicted 1265
5 SASI_Mm02_00425449 predicted 981
6 SASI_Mm02_00425450 predicted 1019
7 SASI_Mm02_00425451 predicted 1243
8 SASI_Mm02_00425452 predicted 1011
9 SASI_Mm02_00425453 predicted 1486
10 SASI_Mm02_00425454 predicted 913
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002766
VALIDATED
PRPSAP1 MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate synthetase-associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000045453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002766.1-767s1c1
Sequence:CCGGCCGATAACTGTAGTTGGAGATCTCGAGATCTCCAACTACAGTTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002766.1-1000s1c1
Sequence:CCGGGCTGCAATGTCCCAAGATAAACTCGAGTTTATCTTGGGACATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002766.1-483s1c1
Sequence:CCGGGCTTTCCTGTGGACAACCTTACTCGAGTAAGGTTGTCCACAGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002766.1-421s1c1
Sequence:CCGGAGCAGGTTTAACTCACATTATCTCGAGATAATGTGAGTTAAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002766.1-876s1c1
Sequence:CCGGGCGCCTATAAGATCTATGTTACTCGAGTAACATAGATCTTATAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002766.2-1484s21c1
Sequence:CCGGGCTGCAATGTCCCAAGATAAACTCGAGTTTATCTTGGGACATTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002766.2-1251s21c1
Sequence:CCGGCCGATAACTGTAGTTGGAGATCTCGAGATCTCCAACTACAGTTATCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002766.2-967s21c1
Sequence:CCGGGCTTTCCTGTGGACAACCTTACTCGAGTAAGGTTGTCCACAGGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002766.2-905s21c1
Sequence:CCGGAGCAGGTTTAACTCACATTATCTCGAGATAATGTGAGTTAAACCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002766
VALIDATED
PRPSAP1 MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate synthetase-associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000045453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002766.1-767s1c1
Sequence:CCGGCCGATAACTGTAGTTGGAGATCTCGAGATCTCCAACTACAGTTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002766.1-1000s1c1
Sequence:CCGGGCTGCAATGTCCCAAGATAAACTCGAGTTTATCTTGGGACATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002766.1-483s1c1
Sequence:CCGGGCTTTCCTGTGGACAACCTTACTCGAGTAAGGTTGTCCACAGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002766.1-421s1c1
Sequence:CCGGAGCAGGTTTAACTCACATTATCTCGAGATAATGTGAGTTAAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002766.1-876s1c1
Sequence:CCGGGCGCCTATAAGATCTATGTTACTCGAGTAACATAGATCTTATAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002766.2-1484s21c1
Sequence:CCGGGCTGCAATGTCCCAAGATAAACTCGAGTTTATCTTGGGACATTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002766.2-1251s21c1
Sequence:CCGGCCGATAACTGTAGTTGGAGATCTCGAGATCTCCAACTACAGTTATCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002766.2-967s21c1
Sequence:CCGGGCTTTCCTGTGGACAACCTTACTCGAGTAAGGTTGTCCACAGGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002766.2-905s21c1
Sequence:CCGGAGCAGGTTTAACTCACATTATCTCGAGATAATGTGAGTTAAACCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002766
VALIDATED
PRPSAP1 MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate synthetase-associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000045453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002766.1-767s1c1
Sequence:CCGGCCGATAACTGTAGTTGGAGATCTCGAGATCTCCAACTACAGTTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002766.1-1000s1c1
Sequence:CCGGGCTGCAATGTCCCAAGATAAACTCGAGTTTATCTTGGGACATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_002766.1-483s1c1
Sequence:CCGGGCTTTCCTGTGGACAACCTTACTCGAGTAAGGTTGTCCACAGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002766.1-421s1c1
Sequence:CCGGAGCAGGTTTAACTCACATTATCTCGAGATAATGTGAGTTAAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002766.1-876s1c1
Sequence:CCGGGCGCCTATAAGATCTATGTTACTCGAGTAACATAGATCTTATAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002766.2-1484s21c1
Sequence:CCGGGCTGCAATGTCCCAAGATAAACTCGAGTTTATCTTGGGACATTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002766.2-1251s21c1
Sequence:CCGGCCGATAACTGTAGTTGGAGATCTCGAGATCTCCAACTACAGTTATCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315730    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_002766.2-967s21c1
Sequence:CCGGGCTTTCCTGTGGACAACCTTACTCGAGTAAGGTTGTCCACAGGAAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002766.2-905s21c1
Sequence:CCGGAGCAGGTTTAACTCACATTATCTCGAGATAATGTGAGTTAAACCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_181343
PRPSAP1 MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate synthetase-associated protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000079115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-637s1c1
Sequence:CCGGGTTGTATATCAGGAGACCAATCTCGAGATTGGTCTCCTGATATACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-997s1c1
Sequence:CCGGCTTCAGTATATCCAGGAAGAACTCGAGTTCTTCCTGGATATACTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-196s1c1
Sequence:CCGGCCGCTCCAGAACAGCTCCAAACTCGAGTTTGGAGCTGTTCTGGAGCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_181343.2-1769s1c1
Sequence:CCGGGCTGGTAACACCTTCCAGTAACTCGAGTTACTGGAAGGTGTTACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-1512s1c1
Sequence:CCGGCCTGATTCTTTCTGAGGCGATCTCGAGATCGCCTCAGAAAGAATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_181343
PRPSAP1 MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate synthetase-associated protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000079115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-637s1c1
Sequence:CCGGGTTGTATATCAGGAGACCAATCTCGAGATTGGTCTCCTGATATACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-997s1c1
Sequence:CCGGCTTCAGTATATCCAGGAAGAACTCGAGTTCTTCCTGGATATACTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-196s1c1
Sequence:CCGGCCGCTCCAGAACAGCTCCAAACTCGAGTTTGGAGCTGTTCTGGAGCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_181343.2-1769s1c1
Sequence:CCGGGCTGGTAACACCTTCCAGTAACTCGAGTTACTGGAAGGTGTTACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-1512s1c1
Sequence:CCGGCCTGATTCTTTCTGAGGCGATCTCGAGATCGCCTCAGAAAGAATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_181343
PRPSAP1 MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate synthetase-associated protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000079115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-637s1c1
Sequence:CCGGGTTGTATATCAGGAGACCAATCTCGAGATTGGTCTCCTGATATACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-997s1c1
Sequence:CCGGCTTCAGTATATCCAGGAAGAACTCGAGTTCTTCCTGGATATACTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-196s1c1
Sequence:CCGGCCGCTCCAGAACAGCTCCAAACTCGAGTTTGGAGCTGTTCTGGAGCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_181343.2-1769s1c1
Sequence:CCGGGCTGGTAACACCTTCCAGTAACTCGAGTTACTGGAAGGTGTTACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_181343.2-1512s1c1
Sequence:CCGGCCTGATTCTTTCTGAGGCGATCTCGAGATCGCCTCAGAAAGAATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)