EMAIL THIS PAGE TO A FRIEND

PRPSAP2

phosphoribosyl pyrophosphate synthetase-associated protein 2

60 Gene Product Result for
Synonyms: PAP41
UniProtKB ID: O60256, B4E1M8, B7ZKZ1, E7EMY2, Q6IAS2
Gene ID:
Human(5636) Summary: This gene encodes a protein that associates with the enzyme phosphoribosylpyrophosphate synthetase (PRS). PRS catalyzes the formation of phosphoribosylpyrophosphate which is a substrate for synthesis of purine and pyrimidine nucleotides, histidine, tryptophan and NAD. PRS exists as a complex with two catalytic subunits and two associated subunits. This gene encodes a non-catalytic associated subunit of PRS. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(212627) phosphoribosyl pyrophosphate synthetase-associated protein 2
Rat(117272) phosphoribosyl pyrophosphate synthetase-associated protein 2
Zebrafish(406369) phosphoribosyl pyrophosphate synthetase-associated protein 2
dog(489535) phosphoribosyl pyrophosphate synthetase-associated protein 2
domestic cat(101098903) phosphoribosyl pyrophosphate synthetase-associated protein 2
chicken(416521) phosphoribosyl pyrophosphate synthetase-associated protein 2
cow(506111) phosphoribosyl pyrophosphate synthetase-associated protein 2
sheep(101119917) phosphoribosyl pyrophosphate synthetase-associated protein 2
domestic guinea pig(100726266) phosphoribosyl pyrophosphate synthetase-associated protein 2
naked mole-rat(101719949) phosphoribosyl pyrophosphate synthetase-associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002767 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002767 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002767 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144806 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144806 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144806 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002767 Rosetta Predictions human pricing
NM_057131 Rosetta Predictions rat pricing
NM_144806 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042812 predicted 477
2 SASI_Hs01_00042813 predicted 967
3 SASI_Hs01_00042814 predicted 1060
4 SASI_Hs01_00042815 predicted 299
5 SASI_Hs01_00042816 predicted 609
6 SASI_Hs01_00042817 predicted 619
7 SASI_Hs01_00042819 predicted 1130
8 SASI_Hs02_00334390 predicted 628
9 SASI_Hs01_00042820 predicted 726
10 SASI_Hs01_00042821 predicted 1223
11 SASI_Hs01_00042818 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057131 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00041641 predicted 1327
2 SASI_Rn01_00041642 predicted 741
3 SASI_Rn01_00041643 predicted 1196
4 SASI_Rn01_00041644 predicted 1272
5 SASI_Rn01_00041645 predicted 1346
6 SASI_Rn01_00041646 predicted 320
7 SASI_Rn01_00041647 predicted 1091
8 SASI_Rn01_00041649 predicted 1165
9 SASI_Rn02_00267076 predicted 1022
10 SASI_Rn02_00267077 predicted 641
11 SASI_Rn01_00041640 predicted 268
12 SASI_Rn01_00041648 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144806 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157544 predicted 333
2 SASI_Mm02_00340158 predicted 413
3 SASI_Mm02_00340159 predicted 751
4 SASI_Mm01_00157546 predicted 1276
5 SASI_Mm02_00340160 predicted 1000
6 SASI_Mm02_00340161 predicted 746
7 SASI_Mm01_00157548 predicted 1354
8 SASI_Mm02_00340162 predicted 574
9 SASI_Mm01_00157549 predicted 646
10 SASI_Mm01_00157550 predicted 643
11 SASI_Mm01_00157545 predicted 1109
12 SASI_Mm01_00157547 predicted 1111
13 SASI_Mm01_00157551 predicted 391
14 SASI_Mm01_00157552 predicted 1374
15 SASI_Mm01_00157553 predicted 1347
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002767
VALIDATED
PRPSAP2 MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate synthetase-associated protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-1063s21c1
Sequence:CCGGCCTGAAGGAAAGAGGTGCATACTCGAGTATGCACCTCTTTCCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-941s21c1
Sequence:CCGGCCCATGCTGATTCCTAAAGAACTCGAGTTCTTTAGGAATCAGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-1136s1c1
Sequence:CCGGCGGATTGAAGAGTCTGCCATTCTCGAGAATGGCAGACTCTTCAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-941s1c1
Sequence:CCGGCCCATGCTGATTCCTAAAGAACTCGAGTTCTTTAGGAATCAGCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-242s1c1
Sequence:CCGGACCAAGATGAACATAACCAAACTCGAGTTTGGTTATGTTCATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-358s1c1
Sequence:CCGGGCAGGTTTACCAGGAACCTAACTCGAGTTAGGTTCCTGGTAAACCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000045471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-1063s1c1
Sequence:CCGGCCTGAAGGAAAGAGGTGCATACTCGAGTATGCACCTCTTTCCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-242s21c1
Sequence:CCGGACCAAGATGAACATAACCAAACTCGAGTTTGGTTATGTTCATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000315749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-1136s21c1
Sequence:CCGGCGGATTGAAGAGTCTGCCATTCTCGAGAATGGCAGACTCTTCAATCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002767
VALIDATED
PRPSAP2 MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate synthetase-associated protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-1063s21c1
Sequence:CCGGCCTGAAGGAAAGAGGTGCATACTCGAGTATGCACCTCTTTCCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-941s21c1
Sequence:CCGGCCCATGCTGATTCCTAAAGAACTCGAGTTCTTTAGGAATCAGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-1136s1c1
Sequence:CCGGCGGATTGAAGAGTCTGCCATTCTCGAGAATGGCAGACTCTTCAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-941s1c1
Sequence:CCGGCCCATGCTGATTCCTAAAGAACTCGAGTTCTTTAGGAATCAGCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-242s1c1
Sequence:CCGGACCAAGATGAACATAACCAAACTCGAGTTTGGTTATGTTCATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-358s1c1
Sequence:CCGGGCAGGTTTACCAGGAACCTAACTCGAGTTAGGTTCCTGGTAAACCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000045471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-1063s1c1
Sequence:CCGGCCTGAAGGAAAGAGGTGCATACTCGAGTATGCACCTCTTTCCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-242s21c1
Sequence:CCGGACCAAGATGAACATAACCAAACTCGAGTTTGGTTATGTTCATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000315749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-1136s21c1
Sequence:CCGGCGGATTGAAGAGTCTGCCATTCTCGAGAATGGCAGACTCTTCAATCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002767
VALIDATED
PRPSAP2 MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate synthetase-associated protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-1063s21c1
Sequence:CCGGCCTGAAGGAAAGAGGTGCATACTCGAGTATGCACCTCTTTCCTTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000315750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-941s21c1
Sequence:CCGGCCCATGCTGATTCCTAAAGAACTCGAGTTCTTTAGGAATCAGCATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-1136s1c1
Sequence:CCGGCGGATTGAAGAGTCTGCCATTCTCGAGAATGGCAGACTCTTCAATCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-941s1c1
Sequence:CCGGCCCATGCTGATTCCTAAAGAACTCGAGTTCTTTAGGAATCAGCATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-242s1c1
Sequence:CCGGACCAAGATGAACATAACCAAACTCGAGTTTGGTTATGTTCATCTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-358s1c1
Sequence:CCGGGCAGGTTTACCAGGAACCTAACTCGAGTTAGGTTCCTGGTAAACCTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000045471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002767.2-1063s1c1
Sequence:CCGGCCTGAAGGAAAGAGGTGCATACTCGAGTATGCACCTCTTTCCTTCAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000315751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-242s21c1
Sequence:CCGGACCAAGATGAACATAACCAAACTCGAGTTTGGTTATGTTCATCTTGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000315749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_002767.2-1136s21c1
Sequence:CCGGCGGATTGAAGAGTCTGCCATTCTCGAGAATGGCAGACTCTTCAATCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144806
VALIDATED
PRPSAP2 MISSION shRNA Bacterial Glycerol Stock
phosphoribosyl pyrophosphate synthetase-associated protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-1042s21c1
Sequence:CCGGCCATCATTGTGGATGACATTACTCGAGTAATGTCATCCACAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-1473s21c1
Sequence:CCGGTCATTCCTGTGAAGGTACAAGCTCGAGCTTGTACCTTCACAGGAATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144806.1-1562s1c1
Sequence:CCGGCCTCTGAAATGAAAGAAGTTACTCGAGTAACTTCTTTCATTTCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144806.1-635s1c1
Sequence:CCGGGCTGGCTTCTATGATGTGCAACTCGAGTTGCACATCATAGAAGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144806.1-636s1c1
Sequence:CCGGCTGGCTTCTATGATGTGCAAACTCGAGTTTGCACATCATAGAAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144806.1-1041s1c1
Sequence:CCGGGCCATCATTGTGGATGACATTCTCGAGAATGTCATCCACAATGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-770s21c1
Sequence:CCGGAGAAGAGATCCCAGATTATAGCTCGAGCTATAATCTGGGATCTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-715s21c1
Sequence:CCGGTCAATATTCCAGTGGATAATTCTCGAGAATTATCCACTGGAATATTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000295171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-747s21c1
Sequence:CCGGCCATTCCTGTTACAATATATTCTCGAGAATATATTGTAACAGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144806.1-1042s1c1
Sequence:CCGGCCATCATTGTGGATGACATTACTCGAGTAATGTCATCCACAATGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144806
VALIDATED
PRPSAP2 MISSION shRNA shRNA Plasmid DNA
phosphoribosyl pyrophosphate synthetase-associated protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-1042s21c1
Sequence:CCGGCCATCATTGTGGATGACATTACTCGAGTAATGTCATCCACAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-1473s21c1
Sequence:CCGGTCATTCCTGTGAAGGTACAAGCTCGAGCTTGTACCTTCACAGGAATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144806.1-1562s1c1
Sequence:CCGGCCTCTGAAATGAAAGAAGTTACTCGAGTAACTTCTTTCATTTCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144806.1-635s1c1
Sequence:CCGGGCTGGCTTCTATGATGTGCAACTCGAGTTGCACATCATAGAAGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144806.1-636s1c1
Sequence:CCGGCTGGCTTCTATGATGTGCAAACTCGAGTTTGCACATCATAGAAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144806.1-1041s1c1
Sequence:CCGGGCCATCATTGTGGATGACATTCTCGAGAATGTCATCCACAATGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-770s21c1
Sequence:CCGGAGAAGAGATCCCAGATTATAGCTCGAGCTATAATCTGGGATCTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-715s21c1
Sequence:CCGGTCAATATTCCAGTGGATAATTCTCGAGAATTATCCACTGGAATATTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000295171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-747s21c1
Sequence:CCGGCCATTCCTGTTACAATATATTCTCGAGAATATATTGTAACAGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144806.1-1042s1c1
Sequence:CCGGCCATCATTGTGGATGACATTACTCGAGTAATGTCATCCACAATGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144806
VALIDATED
PRPSAP2 MISSION shRNA Lentiviral Transduction Particles
phosphoribosyl pyrophosphate synthetase-associated protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287707    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-1042s21c1
Sequence:CCGGCCATCATTGTGGATGACATTACTCGAGTAATGTCATCCACAATGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295119    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-1473s21c1
Sequence:CCGGTCATTCCTGTGAAGGTACAAGCTCGAGCTTGTACCTTCACAGGAATGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144806.1-1562s1c1
Sequence:CCGGCCTCTGAAATGAAAGAAGTTACTCGAGTAACTTCTTTCATTTCAGAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144806.1-635s1c1
Sequence:CCGGGCTGGCTTCTATGATGTGCAACTCGAGTTGCACATCATAGAAGCCAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144806.1-636s1c1
Sequence:CCGGCTGGCTTCTATGATGTGCAAACTCGAGTTTGCACATCATAGAAGCCAGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075709    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144806.1-1041s1c1
Sequence:CCGGGCCATCATTGTGGATGACATTCTCGAGAATGTCATCCACAATGATGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-770s21c1
Sequence:CCGGAGAAGAGATCCCAGATTATAGCTCGAGCTATAATCTGGGATCTCTTCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-715s21c1
Sequence:CCGGTCAATATTCCAGTGGATAATTCTCGAGAATTATCCACTGGAATATTGATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000295171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144806.1-747s21c1
Sequence:CCGGCCATTCCTGTTACAATATATTCTCGAGAATATATTGTAACAGGAATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000075712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144806.1-1042s1c1
Sequence:CCGGCCATCATTGTGGATGACATTACTCGAGTAATGTCATCCACAATGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???