EMAIL THIS PAGE TO A FRIEND

PRR14

proline rich 14

45 Gene Product Result for
UniProtKB ID: Q9BWN1, Q8WTX2
Gene ID:
Mouse(233895) proline rich 14
Rat(691898) proline rich 14
cow(533235) proline rich 14
sheep(101103694) proline rich 14
naked mole-rat(101697662) proline rich 14
Zebrafish(100001119) proline rich 14
Horse(100063765) proline rich 14
domestic cat(101093068) proline rich 14
dog(607432) proline rich 14
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_024031 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024031 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024031 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024031 Rosetta Predictions human pricing
XM_001080025 Rosetta Predictions rat pricing
NM_145589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00196781 predicted 1653
2 SASI_Hs01_00196782 predicted 661
3 SASI_Hs01_00196783 predicted 1565
4 SASI_Hs01_00196785 predicted 1727
5 SASI_Hs01_00196786 predicted 1828
6 SASI_Hs01_00196787 predicted 1569
7 SASI_Hs01_00196788 predicted 1766
8 SASI_Hs01_00196790 predicted 1822
9 SASI_Hs02_00356455 predicted 580
10 SASI_Hs02_00356456 predicted 806
11 SASI_Hs01_00196784 predicted 1738
12 SASI_Hs01_00196789 predicted 1655
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080025 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00366278 predicted 1065
2 SASI_Rn02_00366279 predicted 1848
3 SASI_Rn02_00366280 predicted 942
4 SASI_Rn02_00366281 predicted 1876
5 SASI_Rn02_00366282 predicted 1297
6 SASI_Rn02_00366283 predicted 1445
7 SASI_Rn02_00366284 predicted 1929
8 SASI_Rn02_00366285 predicted 618
9 SASI_Rn02_00366286 predicted 796
10 SASI_Rn02_00366287 predicted 2104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110458 predicted 1211
2 SASI_Mm01_00110459 predicted 1113
3 SASI_Mm01_00110460 predicted 1214
4 SASI_Mm01_00110461 predicted 1819
5 SASI_Mm01_00110462 predicted 1841
6 SASI_Mm01_00110463 predicted 1828
7 SASI_Mm01_00110464 predicted 1894
8 SASI_Mm01_00110466 predicted 1500
9 SASI_Mm02_00341126 predicted 1641
10 SASI_Mm02_00341127 predicted 1367
11 SASI_Mm01_00110465 predicted 1846
12 SASI_Mm01_00110467 predicted 1854
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145589
VALIDATED
PRR14 MISSION shRNA Bacterial Glycerol Stock
proline rich 14
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145589.2-1984s1c1
Sequence:CCGGCAGTAGAATTTCGGGACAGTACTCGAGTACTGTCCCGAAATTCTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145589.2-957s1c1
Sequence:CCGGCCAACTCTTACTTTGTCCCTTCTCGAGAAGGGACAAAGTAAGAGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145589.2-1044s1c1
Sequence:CCGGCCATTCCAACTGTCTACTCTACTCGAGTAGAGTAGACAGTTGGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145589.2-1935s1c1
Sequence:CCGGGAGCGCAATGGAACTCTGATTCTCGAGAATCAGAGTTCCATTGCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-1984s21c1
Sequence:CCGGCAGTAGAATTTCGGGACAGTACTCGAGTACTGTCCCGAAATTCTACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-1044s21c1
Sequence:CCGGCCATTCCAACTGTCTACTCTACTCGAGTAGAGTAGACAGTTGGAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-957s21c1
Sequence:CCGGCCAACTCTTACTTTGTCCCTTCTCGAGAAGGGACAAAGTAAGAGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-1935s21c1
Sequence:CCGGGAGCGCAATGGAACTCTGATTCTCGAGAATCAGAGTTCCATTGCGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145589
VALIDATED
PRR14 MISSION shRNA shRNA Plasmid DNA
proline rich 14
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145589.2-1984s1c1
Sequence:CCGGCAGTAGAATTTCGGGACAGTACTCGAGTACTGTCCCGAAATTCTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145589.2-957s1c1
Sequence:CCGGCCAACTCTTACTTTGTCCCTTCTCGAGAAGGGACAAAGTAAGAGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000192106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145589.2-1044s1c1
Sequence:CCGGCCATTCCAACTGTCTACTCTACTCGAGTAGAGTAGACAGTTGGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000190549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145589.2-1935s1c1
Sequence:CCGGGAGCGCAATGGAACTCTGATTCTCGAGAATCAGAGTTCCATTGCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000350149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-1984s21c1
Sequence:CCGGCAGTAGAATTTCGGGACAGTACTCGAGTACTGTCCCGAAATTCTACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-1044s21c1
Sequence:CCGGCCATTCCAACTGTCTACTCTACTCGAGTAGAGTAGACAGTTGGAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-957s21c1
Sequence:CCGGCCAACTCTTACTTTGTCCCTTCTCGAGAAGGGACAAAGTAAGAGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-1935s21c1
Sequence:CCGGGAGCGCAATGGAACTCTGATTCTCGAGAATCAGAGTTCCATTGCGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145589
VALIDATED
PRR14 MISSION shRNA Lentiviral Transduction Particles
proline rich 14
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201023    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145589.2-1984s1c1
Sequence:CCGGCAGTAGAATTTCGGGACAGTACTCGAGTACTGTCCCGAAATTCTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145589.2-957s1c1
Sequence:CCGGCCAACTCTTACTTTGTCCCTTCTCGAGAAGGGACAAAGTAAGAGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000192106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145589.2-1044s1c1
Sequence:CCGGCCATTCCAACTGTCTACTCTACTCGAGTAGAGTAGACAGTTGGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000190549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145589.2-1935s1c1
Sequence:CCGGGAGCGCAATGGAACTCTGATTCTCGAGAATCAGAGTTCCATTGCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000350149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-1984s21c1
Sequence:CCGGCAGTAGAATTTCGGGACAGTACTCGAGTACTGTCCCGAAATTCTACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-1044s21c1
Sequence:CCGGCCATTCCAACTGTCTACTCTACTCGAGTAGAGTAGACAGTTGGAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-957s21c1
Sequence:CCGGCCAACTCTTACTTTGTCCCTTCTCGAGAAGGGACAAAGTAAGAGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145589.2-1935s21c1
Sequence:CCGGGAGCGCAATGGAACTCTGATTCTCGAGAATCAGAGTTCCATTGCGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024031
PRR14 MISSION shRNA Bacterial Glycerol Stock
proline rich 14
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1092s1c1
Sequence:CCGGCCCAATGAAGCTGGAGTTGAACTCGAGTTCAACTCCAGCTTCATTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024031.2-1591s1c1
Sequence:CCGGCGATTCAGAATACGCAGAACACTCGAGTGTTCTGCGTATTCTGAATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1678s1c1
Sequence:CCGGGAGTTCAGCTTGGAAGAAATTCTCGAGAATTTCTTCCAAGCTGAACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024031.2-1969s1c1
Sequence:CCGGCTCCTGGAGGAAGAAACAGTACTCGAGTACTGTTTCTTCCTCCAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-421s1c1
Sequence:CCGGGTGCTAGAAGATGTCATGGCTCTCGAGAGCCATGACATCTTCTAGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1662s1c1
Sequence:CCGGCAGGTTGAACAAGAAGGAGTTCTCGAGAACTCCTTCTTGTTCAACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1580s1c1
Sequence:CCGGGAAAGGTTTCTCGATTCAGAACTCGAGTTCTGAATCGAGAAACCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024031
PRR14 MISSION shRNA shRNA Plasmid DNA
proline rich 14
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1092s1c1
Sequence:CCGGCCCAATGAAGCTGGAGTTGAACTCGAGTTCAACTCCAGCTTCATTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024031.2-1591s1c1
Sequence:CCGGCGATTCAGAATACGCAGAACACTCGAGTGTTCTGCGTATTCTGAATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1678s1c1
Sequence:CCGGGAGTTCAGCTTGGAAGAAATTCTCGAGAATTTCTTCCAAGCTGAACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024031.2-1969s1c1
Sequence:CCGGCTCCTGGAGGAAGAAACAGTACTCGAGTACTGTTTCTTCCTCCAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-421s1c1
Sequence:CCGGGTGCTAGAAGATGTCATGGCTCTCGAGAGCCATGACATCTTCTAGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1662s1c1
Sequence:CCGGCAGGTTGAACAAGAAGGAGTTCTCGAGAACTCCTTCTTGTTCAACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1580s1c1
Sequence:CCGGGAAAGGTTTCTCGATTCAGAACTCGAGTTCTGAATCGAGAAACCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024031
PRR14 MISSION shRNA Lentiviral Transduction Particles
proline rich 14
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1092s1c1
Sequence:CCGGCCCAATGAAGCTGGAGTTGAACTCGAGTTCAACTCCAGCTTCATTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136465    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024031.2-1591s1c1
Sequence:CCGGCGATTCAGAATACGCAGAACACTCGAGTGTTCTGCGTATTCTGAATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1678s1c1
Sequence:CCGGGAGTTCAGCTTGGAAGAAATTCTCGAGAATTTCTTCCAAGCTGAACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024031.2-1969s1c1
Sequence:CCGGCTCCTGGAGGAAGAAACAGTACTCGAGTACTGTTTCTTCCTCCAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-421s1c1
Sequence:CCGGGTGCTAGAAGATGTCATGGCTCTCGAGAGCCATGACATCTTCTAGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162276    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1662s1c1
Sequence:CCGGCAGGTTGAACAAGAAGGAGTTCTCGAGAACTCCTTCTTGTTCAACCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159006    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024031.2-1580s1c1
Sequence:CCGGGAAAGGTTTCTCGATTCAGAACTCGAGTTCTGAATCGAGAAACCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)