EMAIL THIS PAGE TO A FRIEND

PRR15

proline rich 15

83 Gene Product Result for
UniProtKB ID: Q8IV56
Gene ID:
Mouse(78004) proline rich 15
Rat(312358) proline rich 15
cow(538952) proline rich 15
sheep(100913167) proline rich 15
naked mole-rat(101699992) proline rich 15
chicken(101666728) proline rich 15
domestic cat(101085964) proline rich 15
dog(611510) proline rich 15
chicken(101750534) proline rich 15
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175887 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175887 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175887 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU101541 MISSION® esiRNA esiRNA human AE000659.1 (esiRNA5) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175887 Rosetta Predictions human pricing
NM_001104527 Rosetta Predictions rat pricing
NM_030024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175887 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112934 predicted 754
2 SASI_Hs01_00112935 predicted 958
3 SASI_Hs01_00112936 predicted 953
4 SASI_Hs01_00112937 predicted 741
5 SASI_Hs01_00112938 predicted 959
6 SASI_Hs01_00112939 predicted 952
7 SASI_Hs02_00369162 predicted 758
8 SASI_Hs01_00112940 predicted 990
9 SASI_Hs01_00112941 predicted 985
10 SASI_Hs01_00112942 predicted 963
11 SASI_Hs01_00112943 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001104527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211636 predicted 581
2 SASI_Rn02_00211637 predicted 1053
3 SASI_Rn02_00211638 predicted 672
4 SASI_Rn02_00211639 predicted 694
5 SASI_Rn02_00211640 predicted 724
6 SASI_Rn02_00211641 predicted 1054
7 SASI_Rn02_00211642 predicted 976
8 SASI_Rn02_00211643 predicted 701
9 SASI_Rn02_00211644 predicted 607
10 SASI_Rn02_00211645 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063683 predicted 631
2 SASI_Mm02_00336399 predicted 464
3 SASI_Mm01_00063684 predicted 565
4 SASI_Mm01_00063685 predicted 570
5 SASI_Mm01_00063686 predicted 526
6 SASI_Mm01_00063687 predicted 659
7 SASI_Mm01_00063689 predicted 683
8 SASI_Mm01_00063690 predicted 660
9 SASI_Mm02_00336400 predicted 685
10 SASI_Mm01_00063691 predicted 687
11 SASI_Mm01_00063688 predicted 670
12 SASI_Mm01_00063692 predicted 679
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030024
PRR15 MISSION shRNA Bacterial Glycerol Stock
proline rich 15
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030024.2-898s1c1
Sequence:CCGGGCAGTTGACTAAGGCCTTCAACTCGAGTTGAAGGCCTTAGTCAACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030024.2-630s1c1
Sequence:CCGGCCCTCAGGTCAGATAAGTTGTCTCGAGACAACTTATCTGACCTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030024.2-876s1c1
Sequence:CCGGGCTTCACCCAAGTTCAGAGTACTCGAGTACTCTGAACTTGGGTGAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030024.2-883s1c1
Sequence:CCGGCCAAGTTCAGAGTATGCAGTTCTCGAGAACTGCATACTCTGAACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030024.2-677s1c1
Sequence:CCGGCGCAATTTGAAGATCTCACGCCTCGAGGCGTGAGATCTTCAAATTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030024
PRR15 MISSION shRNA shRNA Plasmid DNA
proline rich 15
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030024.2-898s1c1
Sequence:CCGGGCAGTTGACTAAGGCCTTCAACTCGAGTTGAAGGCCTTAGTCAACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030024.2-630s1c1
Sequence:CCGGCCCTCAGGTCAGATAAGTTGTCTCGAGACAACTTATCTGACCTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030024.2-876s1c1
Sequence:CCGGGCTTCACCCAAGTTCAGAGTACTCGAGTACTCTGAACTTGGGTGAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000181458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030024.2-883s1c1
Sequence:CCGGCCAAGTTCAGAGTATGCAGTTCTCGAGAACTGCATACTCTGAACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030024.2-677s1c1
Sequence:CCGGCGCAATTTGAAGATCTCACGCCTCGAGGCGTGAGATCTTCAAATTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030024
PRR15 MISSION shRNA Lentiviral Transduction Particles
proline rich 15
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030024.2-898s1c1
Sequence:CCGGGCAGTTGACTAAGGCCTTCAACTCGAGTTGAAGGCCTTAGTCAACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030024.2-630s1c1
Sequence:CCGGCCCTCAGGTCAGATAAGTTGTCTCGAGACAACTTATCTGACCTGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182404    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030024.2-876s1c1
Sequence:CCGGGCTTCACCCAAGTTCAGAGTACTCGAGTACTCTGAACTTGGGTGAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000181458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_030024.2-883s1c1
Sequence:CCGGCCAAGTTCAGAGTATGCAGTTCTCGAGAACTGCATACTCTGAACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030024.2-677s1c1
Sequence:CCGGCGCAATTTGAAGATCTCACGCCTCGAGGCGTGAGATCTTCAAATTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175887
PRR15 MISSION shRNA Bacterial Glycerol Stock
proline rich 15
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-973s1c1
Sequence:CCGGCAATTTGAAGATCTCGCGCTCCTCGAGGAGCGCGAGATCTTCAAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-760s1c1
Sequence:CCGGGCTCACCAACAGCAGAAAGAACTCGAGTTCTTTCTGCTGTTGGTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-999s1c1
Sequence:CCGGGCTTTAAGGAGAAGAGGAAAGCTCGAGCTTTCCTCTTCTCCTTAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175887.2-1195s1c1
Sequence:CCGGGTTGTCTCATTCCACCAAATTCTCGAGAATTTGGTGGAATGAGACAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-972s1c1
Sequence:CCGGGCAATTTGAAGATCTCGCGCTCTCGAGAGCGCGAGATCTTCAAATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175887.2-1193s1c1
Sequence:CCGGGCGTTGTCTCATTCCACCAAACTCGAGTTTGGTGGAATGAGACAACGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1457s21c1
Sequence:CCGGGCTGTTATTTAGGACTCTGTGCTCGAGCACAGAGTCCTAAATAACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175887.2-926s21c1
Sequence:CCGGCCCAAACCAGACAAGTTATACCTCGAGGTATAACTTGTCTGGTTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1426s21c1
Sequence:CCGGGAACTCTGTAGCCTCTCAAATCTCGAGATTTGAGAGGCTACAGAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1268s21c1
Sequence:CCGGTCAATTGGGTTCTCAATATTTCTCGAGAAATATTGAGAACCCAATTGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1320s21c1
Sequence:CCGGTGTGGTAAGAGAAGATACCTGCTCGAGCAGGTATCTTCTCTTACCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175887
PRR15 MISSION shRNA shRNA Plasmid DNA
proline rich 15
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-973s1c1
Sequence:CCGGCAATTTGAAGATCTCGCGCTCCTCGAGGAGCGCGAGATCTTCAAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-760s1c1
Sequence:CCGGGCTCACCAACAGCAGAAAGAACTCGAGTTCTTTCTGCTGTTGGTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-999s1c1
Sequence:CCGGGCTTTAAGGAGAAGAGGAAAGCTCGAGCTTTCCTCTTCTCCTTAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175887.2-1195s1c1
Sequence:CCGGGTTGTCTCATTCCACCAAATTCTCGAGAATTTGGTGGAATGAGACAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-972s1c1
Sequence:CCGGGCAATTTGAAGATCTCGCGCTCTCGAGAGCGCGAGATCTTCAAATTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175887.2-1193s1c1
Sequence:CCGGGCGTTGTCTCATTCCACCAAACTCGAGTTTGGTGGAATGAGACAACGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1457s21c1
Sequence:CCGGGCTGTTATTTAGGACTCTGTGCTCGAGCACAGAGTCCTAAATAACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175887.2-926s21c1
Sequence:CCGGCCCAAACCAGACAAGTTATACCTCGAGGTATAACTTGTCTGGTTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1426s21c1
Sequence:CCGGGAACTCTGTAGCCTCTCAAATCTCGAGATTTGAGAGGCTACAGAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1268s21c1
Sequence:CCGGTCAATTGGGTTCTCAATATTTCTCGAGAAATATTGAGAACCCAATTGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1320s21c1
Sequence:CCGGTGTGGTAAGAGAAGATACCTGCTCGAGCAGGTATCTTCTCTTACCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175887
PRR15 MISSION shRNA Lentiviral Transduction Particles
proline rich 15
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166295    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-973s1c1
Sequence:CCGGCAATTTGAAGATCTCGCGCTCCTCGAGGAGCGCGAGATCTTCAAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165250    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-760s1c1
Sequence:CCGGGCTCACCAACAGCAGAAAGAACTCGAGTTCTTTCTGCTGTTGGTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-999s1c1
Sequence:CCGGGCTTTAAGGAGAAGAGGAAAGCTCGAGCTTTCCTCTTCTCCTTAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161324    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175887.2-1195s1c1
Sequence:CCGGGTTGTCTCATTCCACCAAATTCTCGAGAATTTGGTGGAATGAGACAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165199    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175887.2-972s1c1
Sequence:CCGGGCAATTTGAAGATCTCGCGCTCTCGAGAGCGCGAGATCTTCAAATTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165528    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175887.2-1193s1c1
Sequence:CCGGGCGTTGTCTCATTCCACCAAACTCGAGTTTGGTGGAATGAGACAACGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429913    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1457s21c1
Sequence:CCGGGCTGTTATTTAGGACTCTGTGCTCGAGCACAGAGTCCTAAATAACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426318    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175887.2-926s21c1
Sequence:CCGGCCCAAACCAGACAAGTTATACCTCGAGGTATAACTTGTCTGGTTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1426s21c1
Sequence:CCGGGAACTCTGTAGCCTCTCAAATCTCGAGATTTGAGAGGCTACAGAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422251    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1268s21c1
Sequence:CCGGTCAATTGGGTTCTCAATATTTCTCGAGAAATATTGAGAACCCAATTGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429216    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175887.2-1320s21c1
Sequence:CCGGTGTGGTAAGAGAAGATACCTGCTCGAGCAGGTATCTTCTCTTACCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)