EMAIL THIS PAGE TO A FRIEND

PRR20A

proline rich 20A

16 Gene Product Result for
Synonyms: PRR20
Species: Human PRR20A(122183)
UniProtKB ID: P86496, Q8N7V5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198441 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198441 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198441 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198441 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198441 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130881 predicted 1273
2 SASI_Hs01_00130882 predicted 1086
3 SASI_Hs01_00130883 predicted 1006
4 SASI_Hs02_00371951 predicted 1267
5 SASI_Hs01_00130884 predicted 1079
6 SASI_Hs01_00130885 predicted 776
7 SASI_Hs02_00371952 predicted 1085
8 SASI_Hs01_00130887 predicted 866
9 SASI_Hs01_00130888 predicted 1096
10 SASI_Hs01_00130889 predicted 1156
11 SASI_Hs01_00130886 predicted 1246
12 SASI_Hs01_00130890 predicted 1049
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198441
PRR20A MISSION shRNA Bacterial Glycerol Stock
proline rich 20A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198441.2-1350s21c1
Sequence:CCGGGACGATAGACTGGCTGAATATCTCGAGATATTCAGCCAGTCTATCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-781s21c1
Sequence:CCGGTCTATCCCTGCATCGGGTTTACTCGAGTAAACCCGATGCAGGGATAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-755s21c1
Sequence:CCGGTGTTGACTGGCAACCCGTCTTCTCGAGAAGACGGGTTGCCAGTCAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-871s21c1
Sequence:CCGGCAGTGTTCCTCACCGACATTGCTCGAGCAATGTCGGTGAGGAACACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-383s21c1
Sequence:CCGGACCCATCGCTTACGTGAAACCCTCGAGGGTTTCACGTAAGCGATGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198441.1-1185s1c1
Sequence:CCGGCATGGAAATTAGGAAACTGTACTCGAGTACAGTTTCCTAATTTCCATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198441.1-390s1c1
Sequence:CCGGGCTTACGTGAAACCCTTCAGACTCGAGTCTGAAGGGTTTCACGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198441
PRR20A MISSION shRNA shRNA Plasmid DNA
proline rich 20A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198441.2-1350s21c1
Sequence:CCGGGACGATAGACTGGCTGAATATCTCGAGATATTCAGCCAGTCTATCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-781s21c1
Sequence:CCGGTCTATCCCTGCATCGGGTTTACTCGAGTAAACCCGATGCAGGGATAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-755s21c1
Sequence:CCGGTGTTGACTGGCAACCCGTCTTCTCGAGAAGACGGGTTGCCAGTCAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000263302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-871s21c1
Sequence:CCGGCAGTGTTCCTCACCGACATTGCTCGAGCAATGTCGGTGAGGAACACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000281586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-383s21c1
Sequence:CCGGACCCATCGCTTACGTGAAACCCTCGAGGGTTTCACGTAAGCGATGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198441.1-1185s1c1
Sequence:CCGGCATGGAAATTAGGAAACTGTACTCGAGTACAGTTTCCTAATTTCCATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198441.1-390s1c1
Sequence:CCGGGCTTACGTGAAACCCTTCAGACTCGAGTCTGAAGGGTTTCACGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198441
PRR20A MISSION shRNA Lentiviral Transduction Particles
proline rich 20A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198441.2-1350s21c1
Sequence:CCGGGACGATAGACTGGCTGAATATCTCGAGATATTCAGCCAGTCTATCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-781s21c1
Sequence:CCGGTCTATCCCTGCATCGGGTTTACTCGAGTAAACCCGATGCAGGGATAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-755s21c1
Sequence:CCGGTGTTGACTGGCAACCCGTCTTCTCGAGAAGACGGGTTGCCAGTCAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000263302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-871s21c1
Sequence:CCGGCAGTGTTCCTCACCGACATTGCTCGAGCAATGTCGGTGAGGAACACTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000281586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198441.2-383s21c1
Sequence:CCGGACCCATCGCTTACGTGAAACCCTCGAGGGTTTCACGTAAGCGATGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167147    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198441.1-1185s1c1
Sequence:CCGGCATGGAAATTAGGAAACTGTACTCGAGTACAGTTTCCTAATTTCCATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172798    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198441.1-390s1c1
Sequence:CCGGGCTTACGTGAAACCCTTCAGACTCGAGTCTGAAGGGTTTCACGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)