EMAIL THIS PAGE TO A FRIEND

PRR20B

proline rich 20B

12 Gene Product Result for
Species: Human PRR20B(729233)
UniProtKB ID: P86481, Q8N7V5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001130404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001130404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001130404 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001132952 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001132952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00390017 predicted 1268
2 SASI_Hs02_00390018 predicted 1088
3 SASI_Hs02_00390019 predicted 1007
4 SASI_Hs02_00390020 predicted 1274
5 SASI_Hs02_00390021 predicted 1079
6 SASI_Hs02_00390022 predicted 779
7 SASI_Hs02_00390023 predicted 1090
8 SASI_Hs02_00390024 predicted 862
9 SASI_Hs02_00390025 predicted 1093
10 SASI_Hs02_00390026 predicted 1162
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130404
PRR20B MISSION shRNA Bacterial Glycerol Stock
proline rich 20B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000269811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-635s21c1
Sequence:CCGGAGCCTTCTCCCTTTCTGAAACCTCGAGGTTTCAGAAAGGGAGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130404.1-1567s21c1
Sequence:CCGGGACTCACTGGAACCGCTAAACCTCGAGGTTTAGCGGTTCCAGTGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-783s21c1
Sequence:CCGGTATCCCTGCATCGGGTTTAGGCTCGAGCCTAAACCCGATGCAGGGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-877s21c1
Sequence:CCGGTCCTCACCGACATTGCGTATTCTCGAGAATACGCAATGTCGGTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-391s21c1
Sequence:CCGGCTTACGTGAAACCCTTCAGACCTCGAGGTCTGAAGGGTTTCACGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130404
PRR20B MISSION shRNA shRNA Plasmid DNA
proline rich 20B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000269811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-635s21c1
Sequence:CCGGAGCCTTCTCCCTTTCTGAAACCTCGAGGTTTCAGAAAGGGAGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130404.1-1567s21c1
Sequence:CCGGGACTCACTGGAACCGCTAAACCTCGAGGTTTAGCGGTTCCAGTGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-783s21c1
Sequence:CCGGTATCCCTGCATCGGGTTTAGGCTCGAGCCTAAACCCGATGCAGGGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-877s21c1
Sequence:CCGGTCCTCACCGACATTGCGTATTCTCGAGAATACGCAATGTCGGTGAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-391s21c1
Sequence:CCGGCTTACGTGAAACCCTTCAGACCTCGAGGTCTGAAGGGTTTCACGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130404
PRR20B MISSION shRNA Lentiviral Transduction Particles
proline rich 20B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000269811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-635s21c1
Sequence:CCGGAGCCTTCTCCCTTTCTGAAACCTCGAGGTTTCAGAAAGGGAGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001130404.1-1567s21c1
Sequence:CCGGGACTCACTGGAACCGCTAAACCTCGAGGTTTAGCGGTTCCAGTGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269812    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-783s21c1
Sequence:CCGGTATCCCTGCATCGGGTTTAGGCTCGAGCCTAAACCCGATGCAGGGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-877s21c1
Sequence:CCGGTCCTCACCGACATTGCGTATTCTCGAGAATACGCAATGTCGGTGAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130404.1-391s21c1
Sequence:CCGGCTTACGTGAAACCCTTCAGACCTCGAGGTCTGAAGGGTTTCACGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)