EMAIL THIS PAGE TO A FRIEND

PRR20D

proline rich 20D

12 Gene Product Result for
Species: Human PRR20D(729246)
UniProtKB ID: P86480, Q8N7V5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001130406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001130406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001130406 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001132961 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001132961 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00390047 predicted 1268
2 SASI_Hs02_00390048 predicted 1084
3 SASI_Hs02_00390049 predicted 1012
4 SASI_Hs02_00390050 predicted 1267
5 SASI_Hs02_00390051 predicted 1080
6 SASI_Hs02_00390052 predicted 770
7 SASI_Hs02_00390053 predicted 1089
8 SASI_Hs02_00390054 predicted 861
9 SASI_Hs02_00390055 predicted 1096
10 SASI_Hs02_00390056 predicted 1154
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001130406
PRR20D MISSION shRNA Bacterial Glycerol Stock
proline rich 20D
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-573s21c1
Sequence:CCGGATCCAACTGGACCACCATGGACTCGAGTCCATGGTGGTCCAGTTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-887s21c1
Sequence:CCGGCATTGCGTATTGACCACTATCCTCGAGGATAGTGGTCAATACGCAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-782s21c1
Sequence:CCGGCTATCCCTGCATCGGGTTTAGCTCGAGCTAAACCCGATGCAGGGATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-389s21c1
Sequence:CCGGCGCTTACGTGAAACCCTTCAGCTCGAGCTGAAGGGTTTCACGTAAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001130406
PRR20D MISSION shRNA shRNA Plasmid DNA
proline rich 20D
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-573s21c1
Sequence:CCGGATCCAACTGGACCACCATGGACTCGAGTCCATGGTGGTCCAGTTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-887s21c1
Sequence:CCGGCATTGCGTATTGACCACTATCCTCGAGGATAGTGGTCAATACGCAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-782s21c1
Sequence:CCGGCTATCCCTGCATCGGGTTTAGCTCGAGCTAAACCCGATGCAGGGATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-389s21c1
Sequence:CCGGCGCTTACGTGAAACCCTTCAGCTCGAGCTGAAGGGTTTCACGTAAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001130406
PRR20D MISSION shRNA Lentiviral Transduction Particles
proline rich 20D
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-573s21c1
Sequence:CCGGATCCAACTGGACCACCATGGACTCGAGTCCATGGTGGTCCAGTTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-887s21c1
Sequence:CCGGCATTGCGTATTGACCACTATCCTCGAGGATAGTGGTCAATACGCAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-782s21c1
Sequence:CCGGCTATCCCTGCATCGGGTTTAGCTCGAGCTAAACCCGATGCAGGGATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001130406.1-389s21c1
Sequence:CCGGCGCTTACGTGAAACCCTTCAGCTCGAGCTGAAGGGTTTCACGTAAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)