EMAIL THIS PAGE TO A FRIEND

PRR22

proline rich 22

33 Gene Product Result for
UniProtKB ID: Q8IZ63, E9PB31
Gene ID:
Mouse(100504446) proline rich 22
Rat(680177) proline rich 22
naked mole-rat(101714609) proline rich 22
cow(616551) proline rich 22
sheep(101111021) proline rich 22
dog(611770) proline rich 22
domestic cat(101084685) proline rich 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153359 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153359 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153359 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU229851 MISSION® esiRNA esiRNA targeting human PRR22 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153359 Rosetta Predictions human pricing
NM_001126375 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187546 predicted 577
2 SASI_Hs01_00187547 predicted 1218
3 SASI_Hs01_00187548 predicted 1190
4 SASI_Hs01_00187549 predicted 1313
5 SASI_Hs01_00187552 predicted 1212
6 SASI_Hs01_00187553 predicted 362
7 SASI_Hs02_00367224 predicted 631
8 SASI_Hs01_00187554 predicted 1394
9 SASI_Hs02_00367225 predicted 1303
10 SASI_Hs02_00367226 predicted 1292
11 SASI_Hs01_00187550 predicted 375
12 SASI_Hs01_00187551 predicted 1378
13 SASI_Hs01_00187555 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126375 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253453 predicted 1259
2 SASI_Rn02_00253454 predicted 997
3 SASI_Rn02_00253455 predicted 856
4 SASI_Rn02_00253456 predicted 1228
5 SASI_Rn02_00253457 predicted 1265
6 SASI_Rn02_00253458 predicted 1255
7 SASI_Rn02_00253459 predicted 870
8 SASI_Rn02_00253460 predicted 1393
9 SASI_Rn02_00253461 predicted 1046
10 SASI_Rn02_00253462 predicted 1272
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153359
PRR22 MISSION shRNA Bacterial Glycerol Stock
proline rich 22
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1415s1c1
Sequence:CCGGCTTCTTCAACTTCAAGGCGCTCTCGAGAGCGCCTTGAAGTTGAAGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1403s1c1
Sequence:CCGGCAACGTTGACTACTTCTTCAACTCGAGTTGAAGAAGTAGTCAACGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1406s1c1
Sequence:CCGGCGTTGACTACTTCTTCAACTTCTCGAGAAGTTGAAGAAGTAGTCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-408s1c1
Sequence:CCGGCCAAAGCAATATCTATGTCGTCTCGAGACGACATAGATATTGCTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1400s1c1
Sequence:CCGGGTCCAACGTTGACTACTTCTTCTCGAGAAGAAGTAGTCAACGTTGGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1490s1c1
Sequence:CCGGCATTCTGTCTGGCAAGAGAAACTCGAGTTTCTCTTGCCAGACAGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1489s1c1
Sequence:CCGGCCATTCTGTCTGGCAAGAGAACTCGAGTTCTCTTGCCAGACAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1402s1c1
Sequence:CCGGCCAACGTTGACTACTTCTTCACTCGAGTGAAGAAGTAGTCAACGTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153359
PRR22 MISSION shRNA shRNA Plasmid DNA
proline rich 22
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1415s1c1
Sequence:CCGGCTTCTTCAACTTCAAGGCGCTCTCGAGAGCGCCTTGAAGTTGAAGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1403s1c1
Sequence:CCGGCAACGTTGACTACTTCTTCAACTCGAGTTGAAGAAGTAGTCAACGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000160740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1406s1c1
Sequence:CCGGCGTTGACTACTTCTTCAACTTCTCGAGAAGTTGAAGAAGTAGTCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000162486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-408s1c1
Sequence:CCGGCCAAAGCAATATCTATGTCGTCTCGAGACGACATAGATATTGCTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1400s1c1
Sequence:CCGGGTCCAACGTTGACTACTTCTTCTCGAGAAGAAGTAGTCAACGTTGGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1490s1c1
Sequence:CCGGCATTCTGTCTGGCAAGAGAAACTCGAGTTTCTCTTGCCAGACAGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1489s1c1
Sequence:CCGGCCATTCTGTCTGGCAAGAGAACTCGAGTTCTCTTGCCAGACAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1402s1c1
Sequence:CCGGCCAACGTTGACTACTTCTTCACTCGAGTGAAGAAGTAGTCAACGTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153359
PRR22 MISSION shRNA Lentiviral Transduction Particles
proline rich 22
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1415s1c1
Sequence:CCGGCTTCTTCAACTTCAAGGCGCTCTCGAGAGCGCCTTGAAGTTGAAGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162522    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1403s1c1
Sequence:CCGGCAACGTTGACTACTTCTTCAACTCGAGTTGAAGAAGTAGTCAACGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000160740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1406s1c1
Sequence:CCGGCGTTGACTACTTCTTCAACTTCTCGAGAAGTTGAAGAAGTAGTCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000162486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-408s1c1
Sequence:CCGGCCAAAGCAATATCTATGTCGTCTCGAGACGACATAGATATTGCTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1400s1c1
Sequence:CCGGGTCCAACGTTGACTACTTCTTCTCGAGAAGAAGTAGTCAACGTTGGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1490s1c1
Sequence:CCGGCATTCTGTCTGGCAAGAGAAACTCGAGTTTCTCTTGCCAGACAGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165768    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1489s1c1
Sequence:CCGGCCATTCTGTCTGGCAAGAGAACTCGAGTTCTCTTGCCAGACAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164582    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153359.1-1402s1c1
Sequence:CCGGCCAACGTTGACTACTTCTTCACTCGAGTGAAGAAGTAGTCAACGTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)