EMAIL THIS PAGE TO A FRIEND

PRR23B

proline rich 23B

15 Gene Product Result for
UniProtKB ID: Q6ZRT6, B2RNV9
Gene ID:
cow(616668) proline rich 23B
sheep(101110206) proline rich 23B
domestic cat(101100079) proline rich 23B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013650 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013650 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013650 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013650 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013650 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216593 predicted 1126
2 SASI_Hs02_00306422 predicted 1333
3 SASI_Hs01_00216594 predicted 1330
4 SASI_Hs01_00216595 predicted 1169
5 SASI_Hs01_00216596 predicted 1110
6 SASI_Hs01_00216597 predicted 513
7 SASI_Hs01_00216598 predicted 329
8 SASI_Hs02_00306423 predicted 1111
9 SASI_Hs01_00216599 predicted 1124
10 SASI_Hs01_00216600 predicted 1130
11 SASI_Hs01_00216601 predicted 1171
12 SASI_Hs01_00216602 predicted 1131
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013650
PRR23B MISSION shRNA Bacterial Glycerol Stock
proline rich 23B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013650.2-1122s21c1
Sequence:CCGGTTGCGGGAATCTCTCACATTGCTCGAGCAATGTGAGAGATTCCCGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013650.2-806s21c1
Sequence:CCGGTCCTCTAGAAGTATGTTCATCCTCGAGGATGAACATACTTCTAGAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013650.2-1045s21c1
Sequence:CCGGACGCCTGTTCCAGGCATAGACCTCGAGGTCTATGCCTGGAACAGGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168298    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1360s1c1
Sequence:CCGGGCATCAGTTGTTTCTCTCAAACTCGAGTTTGAGAGAAACAACTGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1361s1c1
Sequence:CCGGCATCAGTTGTTTCTCTCAAATCTCGAGATTTGAGAGAAACAACTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1558s1c1
Sequence:CCGGGCTTACTATACAAGACTGTATCTCGAGATACAGTCTTGTATAGTAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168253    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1452s1c1
Sequence:CCGGCGTTGTTAGTTACCTTGCATTCTCGAGAATGCAAGGTAACTAACAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1144s1c1
Sequence:CCGGGTATCCAACAACCTGGAAATTCTCGAGAATTTCCAGGTTGTTGGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013650
PRR23B MISSION shRNA shRNA Plasmid DNA
proline rich 23B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013650.2-1122s21c1
Sequence:CCGGTTGCGGGAATCTCTCACATTGCTCGAGCAATGTGAGAGATTCCCGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013650.2-806s21c1
Sequence:CCGGTCCTCTAGAAGTATGTTCATCCTCGAGGATGAACATACTTCTAGAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013650.2-1045s21c1
Sequence:CCGGACGCCTGTTCCAGGCATAGACCTCGAGGTCTATGCCTGGAACAGGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168298    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1360s1c1
Sequence:CCGGGCATCAGTTGTTTCTCTCAAACTCGAGTTTGAGAGAAACAACTGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1361s1c1
Sequence:CCGGCATCAGTTGTTTCTCTCAAATCTCGAGATTTGAGAGAAACAACTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1558s1c1
Sequence:CCGGGCTTACTATACAAGACTGTATCTCGAGATACAGTCTTGTATAGTAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168253    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1452s1c1
Sequence:CCGGCGTTGTTAGTTACCTTGCATTCTCGAGAATGCAAGGTAACTAACAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1144s1c1
Sequence:CCGGGTATCCAACAACCTGGAAATTCTCGAGAATTTCCAGGTTGTTGGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013650
PRR23B MISSION shRNA Lentiviral Transduction Particles
proline rich 23B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437859    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013650.2-1122s21c1
Sequence:CCGGTTGCGGGAATCTCTCACATTGCTCGAGCAATGTGAGAGATTCCCGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013650.2-806s21c1
Sequence:CCGGTCCTCTAGAAGTATGTTCATCCTCGAGGATGAACATACTTCTAGAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013650.2-1045s21c1
Sequence:CCGGACGCCTGTTCCAGGCATAGACCTCGAGGTCTATGCCTGGAACAGGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168298    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1360s1c1
Sequence:CCGGGCATCAGTTGTTTCTCTCAAACTCGAGTTTGAGAGAAACAACTGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166844    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1361s1c1
Sequence:CCGGCATCAGTTGTTTCTCTCAAATCTCGAGATTTGAGAGAAACAACTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167462    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1558s1c1
Sequence:CCGGGCTTACTATACAAGACTGTATCTCGAGATACAGTCTTGTATAGTAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168253    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1452s1c1
Sequence:CCGGCGTTGTTAGTTACCTTGCATTCTCGAGAATGCAAGGTAACTAACAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001013650.1-1144s1c1
Sequence:CCGGGTATCCAACAACCTGGAAATTCTCGAGAATTTCCAGGTTGTTGGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)