EMAIL THIS PAGE TO A FRIEND

PRR24

proline rich 24

47 Gene Product Result for
UniProtKB ID: C9JVW0
Gene ID:
Mouse(66300) proline rich 24
Rat(100192314) proline rich 24
dog(100688014) proline rich 24
cow(100297019) proline rich 24
naked mole-rat(101714270) proline rich 24
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001136270 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001136270 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001136270 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178511 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178511 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178511 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002797 Rosetta Predictions human pricing
XM_001476774 Rosetta Predictions mouse pricing
XM_001480001 Rosetta Predictions mouse pricing
XM_984482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002797 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00376903 predicted 515
2 SASI_Hs02_00376904 predicted 506
3 SASI_Hs02_00376905 predicted 506
4 SASI_Hs02_00376906 predicted 514
5 SASI_Hs02_00376907 predicted 362
6 SASI_Hs02_00376908 predicted 511
7 SASI_Hs02_00376909 predicted 345
8 SASI_Hs02_00376910 predicted 368
9 SASI_Hs02_00376911 predicted 482
10 SASI_Hs02_00376912 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001476774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00391260 predicted 832
2 SASI_Mm02_00391261 predicted 771
3 SASI_Mm02_00391262 predicted 1029
4 SASI_Mm02_00391263 predicted 833
5 SASI_Mm02_00391264 predicted 829
6 SASI_Mm02_00391265 predicted 769
7 SASI_Mm02_00391266 predicted 940
8 SASI_Mm02_00391267 predicted 1026
9 SASI_Mm02_00391268 predicted 926
10 SASI_Mm02_00391269 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001480001 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00414277 predicted 1234
2 SASI_Mm02_00414278 predicted 891
3 SASI_Mm02_00414279 predicted 1300
4 SASI_Mm02_00414280 predicted 1106
5 SASI_Mm02_00414281 predicted 1127
6 SASI_Mm02_00414282 predicted 1190
7 SASI_Mm02_00414283 predicted 924
8 SASI_Mm02_00414284 predicted 1050
9 SASI_Mm02_00414285 predicted 1202
10 SASI_Mm02_00414286 predicted 905
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_984482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00215567 predicted 1119
2 SASI_Mm01_00215568 predicted 1427
3 SASI_Mm01_00215569 predicted 1607
4 SASI_Mm01_00215570 predicted 776
5 SASI_Mm01_00215571 predicted 1112
6 SASI_Mm01_00215572 predicted 1111
7 SASI_Mm01_00215573 predicted 775
8 SASI_Mm01_00215574 predicted 1436
9 SASI_Mm01_00215575 predicted 1485
10 SASI_Mm01_00215576 predicted 1149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001136270
PRR24 MISSION shRNA Bacterial Glycerol Stock
proline rich 24
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000269607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-1044s21c1
Sequence:CCGGCTCATTGCTCACATGTAATTTCTCGAGAAATTACATGTGAGCAATGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-884s21c1
Sequence:CCGGCTGATCCTGCCCGACCTTATTCTCGAGAATAAGGTCGGGCAGGATCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-1281s21c1
Sequence:CCGGTTGGAAGTGTGGAGCATATAGCTCGAGCTATATGCTCCACACTTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-927s21c1
Sequence:CCGGTCAGCGCTCATCGGCAATAAACTCGAGTTTATTGCCGATGAGCGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001136270
PRR24 MISSION shRNA shRNA Plasmid DNA
proline rich 24
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000269607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-1044s21c1
Sequence:CCGGCTCATTGCTCACATGTAATTTCTCGAGAAATTACATGTGAGCAATGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-884s21c1
Sequence:CCGGCTGATCCTGCCCGACCTTATTCTCGAGAATAAGGTCGGGCAGGATCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-1281s21c1
Sequence:CCGGTTGGAAGTGTGGAGCATATAGCTCGAGCTATATGCTCCACACTTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000269608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-927s21c1
Sequence:CCGGTCAGCGCTCATCGGCAATAAACTCGAGTTTATTGCCGATGAGCGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001136270
PRR24 MISSION shRNA Lentiviral Transduction Particles
proline rich 24
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000269607    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-1044s21c1
Sequence:CCGGCTCATTGCTCACATGTAATTTCTCGAGAAATTACATGTGAGCAATGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269548    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-884s21c1
Sequence:CCGGCTGATCCTGCCCGACCTTATTCTCGAGAATAAGGTCGGGCAGGATCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269545    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-1281s21c1
Sequence:CCGGTTGGAAGTGTGGAGCATATAGCTCGAGCTATATGCTCCACACTTCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000269608    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001136270.1-927s21c1
Sequence:CCGGTCAGCGCTCATCGGCAATAAACTCGAGTTTATTGCCGATGAGCGCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178511
PRR24 MISSION shRNA Bacterial Glycerol Stock
proline rich 24
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178511.3-178s21c1
Sequence:CCGGCCGTGTACTACGGTCTCATCTCTCGAGAGATGAGACCGTAGTACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178511.3-633s21c1
Sequence:CCGGTTGCCTCTTGCAGCTACTCTGCTCGAGCAGAGTAGCTGCAAGAGGCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178511.3-683s21c1
Sequence:CCGGAGATCCCATCCTGAGCTCTGTCTCGAGACAGAGCTCAGGATGGGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178511.3-543s21c1
Sequence:CCGGTGGTCCGGCCTTCTTCCTAATCTCGAGATTAGGAAGAAGGCCGGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178511.3-141s21c1
Sequence:CCGGTACTTCCTCTGCGTCTCGCTACTCGAGTAGCGAGACGCAGAGGAAGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178511
PRR24 MISSION shRNA shRNA Plasmid DNA
proline rich 24
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178511.3-178s21c1
Sequence:CCGGCCGTGTACTACGGTCTCATCTCTCGAGAGATGAGACCGTAGTACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178511.3-633s21c1
Sequence:CCGGTTGCCTCTTGCAGCTACTCTGCTCGAGCAGAGTAGCTGCAAGAGGCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178511.3-683s21c1
Sequence:CCGGAGATCCCATCCTGAGCTCTGTCTCGAGACAGAGCTCAGGATGGGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178511.3-543s21c1
Sequence:CCGGTGGTCCGGCCTTCTTCCTAATCTCGAGATTAGGAAGAAGGCCGGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178511.3-141s21c1
Sequence:CCGGTACTTCCTCTGCGTCTCGCTACTCGAGTAGCGAGACGCAGAGGAAGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178511
PRR24 MISSION shRNA Lentiviral Transduction Particles
proline rich 24
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268867    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178511.3-178s21c1
Sequence:CCGGCCGTGTACTACGGTCTCATCTCTCGAGAGATGAGACCGTAGTACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268822    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178511.3-633s21c1
Sequence:CCGGTTGCCTCTTGCAGCTACTCTGCTCGAGCAGAGTAGCTGCAAGAGGCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268821    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178511.3-683s21c1
Sequence:CCGGAGATCCCATCCTGAGCTCTGTCTCGAGACAGAGCTCAGGATGGGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178511.3-543s21c1
Sequence:CCGGTGGTCCGGCCTTCTTCCTAATCTCGAGATTAGGAAGAAGGCCGGACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178511.3-141s21c1
Sequence:CCGGTACTTCCTCTGCGTCTCGCTACTCGAGTAGCGAGACGCAGAGGAAGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)