EMAIL THIS PAGE TO A FRIEND

PRR25

proline rich 25

17 Gene Product Result for
Synonyms: gs64
Species: Human PRR25(388199)
UniProtKB ID: Q96S07
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001013638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001013638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001013638 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001013638 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00156448 predicted 568
2 SASI_Hs01_00156449 predicted 571
3 SASI_Hs01_00156450 predicted 425
4 SASI_Hs01_00156451 predicted 203
5 SASI_Hs01_00156452 predicted 249
6 SASI_Hs01_00156453 predicted 934
7 SASI_Hs01_00156454 predicted 963
8 SASI_Hs01_00156455 predicted 825
9 SASI_Hs01_00156456 predicted 233
10 SASI_Hs02_00306409 predicted 199
11 SASI_Hs01_00156447 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013638
PRR25 MISSION shRNA Bacterial Glycerol Stock
proline rich 25
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-577s21c1
Sequence:CCGGCGTCTTCTGTCCCTGCATTTACTCGAGTAAATGCAGGGACAGAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-822s21c1
Sequence:CCGGTCGGCCATCATGTGCGAATGTCTCGAGACATTCGCACATGATGGCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-159s21c1
Sequence:CCGGCCAAGCTCCGTCTCGGGAAATCTCGAGATTTCCCGAGACGGAGCTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-625s21c1
Sequence:CCGGCAGCGGATCCCTCTTACAGATCTCGAGATCTGTAAGAGGGATCCGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-206s21c1
Sequence:CCGGCTCACTTCCTGGCTATCTCTACTCGAGTAGAGATAGCCAGGAAGTGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013638
PRR25 MISSION shRNA shRNA Plasmid DNA
proline rich 25
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-577s21c1
Sequence:CCGGCGTCTTCTGTCCCTGCATTTACTCGAGTAAATGCAGGGACAGAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-822s21c1
Sequence:CCGGTCGGCCATCATGTGCGAATGTCTCGAGACATTCGCACATGATGGCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-159s21c1
Sequence:CCGGCCAAGCTCCGTCTCGGGAAATCTCGAGATTTCCCGAGACGGAGCTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-625s21c1
Sequence:CCGGCAGCGGATCCCTCTTACAGATCTCGAGATCTGTAAGAGGGATCCGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000268561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-206s21c1
Sequence:CCGGCTCACTTCCTGGCTATCTCTACTCGAGTAGAGATAGCCAGGAAGTGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013638
PRR25 MISSION shRNA Lentiviral Transduction Particles
proline rich 25
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-577s21c1
Sequence:CCGGCGTCTTCTGTCCCTGCATTTACTCGAGTAAATGCAGGGACAGAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-822s21c1
Sequence:CCGGTCGGCCATCATGTGCGAATGTCTCGAGACATTCGCACATGATGGCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-159s21c1
Sequence:CCGGCCAAGCTCCGTCTCGGGAAATCTCGAGATTTCCCGAGACGGAGCTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-625s21c1
Sequence:CCGGCAGCGGATCCCTCTTACAGATCTCGAGATCTGTAAGAGGGATCCGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000268561    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013638.1-206s21c1
Sequence:CCGGCTCACTTCCTGGCTATCTCTACTCGAGTAGAGATAGCCAGGAAGTGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)