EMAIL THIS PAGE TO A FRIEND

PRR3

proline rich 3

189 Gene Product Result for
Synonyms: CAT56
UniProtKB ID: P79522, A1A4H4, Q5RJB5, Q5STN6
Gene ID:
Mouse(75210) proline-rich polypeptide 3
Rat(361788) proline rich 3
Thale Cress(836132) pseudo-response regulator 3
domestic cat(101092027) proline rich 3
naked mole-rat(101710785) proline rich 3
cow(525344) proline rich 3
Goat(100860984) proline rich 3
sheep(101107642) proline rich 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025263 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001077497 Rosetta Predictions human pricing
NM_025263 Rosetta Predictions human pricing
NM_212544 Rosetta Predictions rat pricing
NM_145487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077497 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00312834 predicted 843
2 SASI_Hs02_00312835 predicted 746
3 SASI_Hs02_00312836 predicted 900
4 SASI_Hs02_00312837 predicted 1164
5 SASI_Hs02_00312838 predicted 900
6 SASI_Hs02_00312839 predicted 953
7 SASI_Hs02_00312840 predicted 970
8 SASI_Hs02_00312841 predicted 1240
9 SASI_Hs02_00312842 predicted 677
10 SASI_Hs02_00312843 predicted 846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209226 predicted 907
2 SASI_Hs01_00209227 predicted 806
3 SASI_Hs01_00209228 predicted 962
4 SASI_Hs01_00209229 predicted 1230
5 SASI_Hs02_00358112 predicted 963
6 SASI_Hs01_00209232 predicted 1022
7 SASI_Hs01_00209235 predicted 1029
8 SASI_Hs02_00358113 predicted 1299
9 SASI_Hs02_00358114 predicted 742
10 SASI_Hs02_00358115 predicted 907
11 SASI_Hs01_00209230 predicted 452
12 SASI_Hs01_00209231 predicted 1524
13 SASI_Hs01_00209233 predicted 668
14 SASI_Hs01_00209234 predicted 1252
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212544 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109330 predicted 923
2 SASI_Rn02_00270567 predicted 754
3 SASI_Rn01_00109331 predicted 955
4 SASI_Rn01_00109332 predicted 1063
5 SASI_Rn01_00109333 predicted 581
6 SASI_Rn01_00109335 predicted 782
7 SASI_Rn01_00109336 predicted 871
8 SASI_Rn01_00109337 predicted 615
9 SASI_Rn01_00109338 predicted 884
10 SASI_Rn02_00270568 predicted 380
11 SASI_Rn01_00109334 predicted 551
12 SASI_Rn01_00109339 predicted 1001
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083566 predicted 1933
2 SASI_Mm01_00083567 predicted 1545
3 SASI_Mm01_00083568 predicted 1407
4 SASI_Mm01_00083569 predicted 1888
5 SASI_Mm01_00083570 predicted 1691
6 SASI_Mm01_00083571 predicted 1402
7 SASI_Mm01_00083572 predicted 1750
8 SASI_Mm01_00083573 predicted 1625
9 SASI_Mm01_00083574 predicted 1843
10 SASI_Mm01_00083575 predicted 1852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025263
PRR3 MISSION shRNA Bacterial Glycerol Stock
proline rich 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000151314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-867s1c1
Sequence:CCGGGTCTCTTATCAAGAATACCTGCTCGAGCAGGTATTCTTGATAAGAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-863s1c1
Sequence:CCGGGCTGGTCTCTTATCAAGAATACTCGAGTATTCTTGATAAGAGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025263.3-1465s21c1
Sequence:CCGGTCTTCTTTCCCGTCATCAAATCTCGAGATTTGATGACGGGAAAGAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-767s1c1
Sequence:CCGGGAGTCAATGCAGAACCTCCTTCTCGAGAAGGAGGTTCTGCATTGACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-825s1c1
Sequence:CCGGCTTTCACAAGGAACAGAGAAACTCGAGTTTCTCTGTTCCTTGTGAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025263.1-1949s1c1
Sequence:CCGGCCACCAGTCCATTCATTTGAACTCGAGTTCAAATGAATGGACTGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025263.1-1822s1c1
Sequence:CCGGCCATTCTTCTCCTGTTGGTTACTCGAGTAACCAACAGGAGAAGAATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025263.1-1322s1c1
Sequence:CCGGGAAACCTCTTTGGTGCTGTTTCTCGAGAAACAGCACCAAAGAGGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-462s1c1
Sequence:CCGGGCCGAAACGAAAGAAGCAGAACTCGAGTTCTGCTTCTTTCGTTTCGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025263.3-1169s21c1
Sequence:CCGGTCTACCATCCAGGCGTCAATGCTCGAGCATTGACGCCTGGATGGTAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025263
PRR3 MISSION shRNA shRNA Plasmid DNA
proline rich 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000151314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-867s1c1
Sequence:CCGGGTCTCTTATCAAGAATACCTGCTCGAGCAGGTATTCTTGATAAGAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-863s1c1
Sequence:CCGGGCTGGTCTCTTATCAAGAATACTCGAGTATTCTTGATAAGAGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025263.3-1465s21c1
Sequence:CCGGTCTTCTTTCCCGTCATCAAATCTCGAGATTTGATGACGGGAAAGAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-767s1c1
Sequence:CCGGGAGTCAATGCAGAACCTCCTTCTCGAGAAGGAGGTTCTGCATTGACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-825s1c1
Sequence:CCGGCTTTCACAAGGAACAGAGAAACTCGAGTTTCTCTGTTCCTTGTGAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025263.1-1949s1c1
Sequence:CCGGCCACCAGTCCATTCATTTGAACTCGAGTTCAAATGAATGGACTGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000152728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025263.1-1822s1c1
Sequence:CCGGCCATTCTTCTCCTGTTGGTTACTCGAGTAACCAACAGGAGAAGAATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025263.1-1322s1c1
Sequence:CCGGGAAACCTCTTTGGTGCTGTTTCTCGAGAAACAGCACCAAAGAGGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-462s1c1
Sequence:CCGGGCCGAAACGAAAGAAGCAGAACTCGAGTTCTGCTTCTTTCGTTTCGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025263.3-1169s21c1
Sequence:CCGGTCTACCATCCAGGCGTCAATGCTCGAGCATTGACGCCTGGATGGTAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025263
PRR3 MISSION shRNA Lentiviral Transduction Particles
proline rich 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000151314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-867s1c1
Sequence:CCGGGTCTCTTATCAAGAATACCTGCTCGAGCAGGTATTCTTGATAAGAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-863s1c1
Sequence:CCGGGCTGGTCTCTTATCAAGAATACTCGAGTATTCTTGATAAGAGACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025263.3-1465s21c1
Sequence:CCGGTCTTCTTTCCCGTCATCAAATCTCGAGATTTGATGACGGGAAAGAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-767s1c1
Sequence:CCGGGAGTCAATGCAGAACCTCCTTCTCGAGAAGGAGGTTCTGCATTGACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-825s1c1
Sequence:CCGGCTTTCACAAGGAACAGAGAAACTCGAGTTTCTCTGTTCCTTGTGAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152729    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025263.1-1949s1c1
Sequence:CCGGCCACCAGTCCATTCATTTGAACTCGAGTTCAAATGAATGGACTGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000152728    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025263.1-1822s1c1
Sequence:CCGGCCATTCTTCTCCTGTTGGTTACTCGAGTAACCAACAGGAGAAGAATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153039    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025263.1-1322s1c1
Sequence:CCGGGAAACCTCTTTGGTGCTGTTTCTCGAGAAACAGCACCAAAGAGGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025263.1-462s1c1
Sequence:CCGGGCCGAAACGAAAGAAGCAGAACTCGAGTTCTGCTTCTTTCGTTTCGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025263.3-1169s21c1
Sequence:CCGGTCTACCATCCAGGCGTCAATGCTCGAGCATTGACGCCTGGATGGTAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145487
VALIDATED
PRR3 MISSION shRNA Bacterial Glycerol Stock
proline rich 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145487.2-1312s1c1
Sequence:CCGGGTATCAATGCCGAACCTCCTTCTCGAGAAGGAGGTTCGGCATTGATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145487.2-1501s21c1
Sequence:CCGGAGAAGGGCCACTGTCGATATGCTCGAGCATATCGACAGTGGCCCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145487.2-1158s21c1
Sequence:CCGGGGTGATCCCAAGTCAGCTTTCCTCGAGGAAAGCTGACTTGGGATCACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145487.2-1536s21c1
Sequence:CCGGTTCTACCATCCAGGCGTCAACCTCGAGGTTGACGCCTGGATGGTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145487.2-1516s1c1
Sequence:CCGGGATATGAAGACCATTGTGCCTCTCGAGAGGCACAATGGTCTTCATATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145487.2-1421s1c1
Sequence:CCGGCAAGAATACCTACCCACCCAACTCGAGTTGGGTGGGTAGGTATTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145487.2-1695s21c1
Sequence:CCGGTTTCATCATCTCTCCTATTTGCTCGAGCAAATAGGAGAGATGATGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145487.2-1408s21c1
Sequence:CCGGGCTGGTCTCTTGTCAAGAATACTCGAGTATTCTTGACAAGAGACCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145487
VALIDATED
PRR3 MISSION shRNA shRNA Plasmid DNA
proline rich 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145487.2-1312s1c1
Sequence:CCGGGTATCAATGCCGAACCTCCTTCTCGAGAAGGAGGTTCGGCATTGATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145487.2-1501s21c1
Sequence:CCGGAGAAGGGCCACTGTCGATATGCTCGAGCATATCGACAGTGGCCCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145487.2-1158s21c1
Sequence:CCGGGGTGATCCCAAGTCAGCTTTCCTCGAGGAAAGCTGACTTGGGATCACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145487.2-1536s21c1
Sequence:CCGGTTCTACCATCCAGGCGTCAACCTCGAGGTTGACGCCTGGATGGTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145487.2-1516s1c1
Sequence:CCGGGATATGAAGACCATTGTGCCTCTCGAGAGGCACAATGGTCTTCATATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145487.2-1421s1c1
Sequence:CCGGCAAGAATACCTACCCACCCAACTCGAGTTGGGTGGGTAGGTATTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145487.2-1695s21c1
Sequence:CCGGTTTCATCATCTCTCCTATTTGCTCGAGCAAATAGGAGAGATGATGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145487.2-1408s21c1
Sequence:CCGGGCTGGTCTCTTGTCAAGAATACTCGAGTATTCTTGACAAGAGACCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145487
VALIDATED
PRR3 MISSION shRNA Lentiviral Transduction Particles
proline rich 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145487.2-1312s1c1
Sequence:CCGGGTATCAATGCCGAACCTCCTTCTCGAGAAGGAGGTTCGGCATTGATACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145487.2-1501s21c1
Sequence:CCGGAGAAGGGCCACTGTCGATATGCTCGAGCATATCGACAGTGGCCCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145487.2-1158s21c1
Sequence:CCGGGGTGATCCCAAGTCAGCTTTCCTCGAGGAAAGCTGACTTGGGATCACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145487.2-1536s21c1
Sequence:CCGGTTCTACCATCCAGGCGTCAACCTCGAGGTTGACGCCTGGATGGTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145487.2-1516s1c1
Sequence:CCGGGATATGAAGACCATTGTGCCTCTCGAGAGGCACAATGGTCTTCATATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145487.2-1421s1c1
Sequence:CCGGCAAGAATACCTACCCACCCAACTCGAGTTGGGTGGGTAGGTATTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241427    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145487.2-1695s21c1
Sequence:CCGGTTTCATCATCTCTCCTATTTGCTCGAGCAAATAGGAGAGATGATGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145487.2-1408s21c1
Sequence:CCGGGCTGGTCTCTTGTCAAGAATACTCGAGTATTCTTGACAAGAGACCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)