EMAIL THIS PAGE TO A FRIEND

PRR5L

proline rich 5 like

136 Gene Product Result for
Synonyms: PROTOR2
UniProtKB ID: Q6MZQ0, A4QN22, E9PKY1, Q96H46, Q9H7V4
Gene ID:
Mouse(72446) proline rich 5 like
Rat(362171) proline rich 5 like
chicken(423162) proline rich 5 like
dog(608532) proline rich 5 like
Horse(100052234) proline rich 5 like
domestic cat(101099499) proline rich 5 like
domestic guinea pig(100724728) proline rich 5 like
naked mole-rat(101725290) proline rich 5 like
cow(505048) proline rich 5 like
sheep(101106878) proline rich 5 like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV42637 Anti-FLJ14213 antibody produced in rabbit IgG fraction of antiserum bovine, mouse, guinea pig, human, rat, dog
western blot pricing
SAB2104978 Anti-FLJ14213 antibody produced in rabbit affinity isolated antibody horse, rat, bovine, human, guinea pig, mouse, rabbit, dog
western blot pricing
SAB3500727 Anti-PRR5L antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunocytochemistry, immunofluorescence, western blot pricing
HPA070174 Anti-PRR5L antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024841 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024841 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024841 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175181 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175181 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175181 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024841 Rosetta Predictions human pricing
NM_001080150 Rosetta Predictions rat pricing
NM_001083810 Rosetta Predictions mouse pricing
NM_001110849 Rosetta Predictions mouse pricing
NM_175181 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00055803 predicted 709
2 SASI_Hs01_00055804 predicted 1134
3 SASI_Hs01_00055805 predicted 709
4 SASI_Hs02_00357409 predicted 1607
5 SASI_Hs01_00055806 predicted 804
6 SASI_Hs01_00055807 predicted 608
7 SASI_Hs02_00357410 predicted 789
8 SASI_Hs01_00055808 predicted 1666
9 SASI_Hs01_00055809 predicted 619
10 SASI_Hs01_00055810 predicted 570
11 SASI_Hs01_00055802 predicted 575
12 SASI_Hs01_00055811 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00208429 predicted 570
2 SASI_Rn02_00208430 predicted 715
3 SASI_Rn02_00208431 predicted 888
4 SASI_Rn02_00208432 predicted 562
5 SASI_Rn02_00208433 predicted 1138
6 SASI_Rn02_00208434 predicted 606
7 SASI_Rn02_00208435 predicted 621
8 SASI_Rn02_00208436 predicted 1481
9 SASI_Rn02_00208437 predicted 901
10 SASI_Rn02_00208438 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083810 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299791 predicted 618
2 SASI_Mm02_00299792 predicted 604
3 SASI_Mm02_00299793 predicted 621
4 SASI_Mm02_00299794 predicted 1431
5 SASI_Mm02_00299795 predicted 1606
6 SASI_Mm02_00299796 predicted 1183
7 SASI_Mm02_00299797 predicted 657
8 SASI_Mm02_00299798 predicted 682
9 SASI_Mm02_00299799 predicted 1532
10 SASI_Mm02_00299800 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110849 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00305928 predicted 475
2 SASI_Mm02_00305929 predicted 471
3 SASI_Mm02_00305930 predicted 482
4 SASI_Mm02_00305931 predicted 1293
5 SASI_Mm02_00305932 predicted 1476
6 SASI_Mm02_00305933 predicted 1043
7 SASI_Mm02_00305934 predicted 521
8 SASI_Mm02_00305935 predicted 542
9 SASI_Mm02_00305936 predicted 1401
10 SASI_Mm02_00305937 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138860 predicted 564
2 SASI_Mm01_00138862 predicted 555
3 SASI_Mm02_00345839 predicted 562
4 SASI_Mm01_00138863 predicted 1381
5 SASI_Mm01_00138864 predicted 1562
6 SASI_Mm01_00138865 predicted 1133
7 SASI_Mm01_00138866 predicted 611
8 SASI_Mm02_00345840 predicted 635
9 SASI_Mm02_00345841 predicted 1484
10 SASI_Mm02_00345842 predicted 619
11 SASI_Mm01_00138861 predicted 620
12 SASI_Mm01_00138867 predicted 616
13 SASI_Mm01_00138868 predicted 547
14 SASI_Mm01_00138869 predicted 799
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024841
PRR5L MISSION shRNA Bacterial Glycerol Stock
proline rich 5 like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-603s1c1
Sequence:CCGGCGGCTGTTGAAGAGTGAACTTCTCGAGAAGTTCACTCTTCAACAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-1143s1c1
Sequence:CCGGCCACTGAATGAGATGGTCTTGCTCGAGCAAGACCATCTCATTCAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-611s1c1
Sequence:CCGGGAAGAGTGAACTTGGATCATTCTCGAGAATGATCCAAGTTCACTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-614s1c1
Sequence:CCGGGAGTGAACTTGGATCATTCATCTCGAGATGAATGATCCAAGTTCACTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-962s1c1
Sequence:CCGGCCCAAGTGAGAGTTATTTGCACTCGAGTGCAAATAACTCTCACTTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024841.4-1573s21c1
Sequence:CCGGTATGCGATGCTGCCTTATTTCCTCGAGGAAATAAGGCAGCATCGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-521s1c1
Sequence:CCGGCGTTCAGACTGCTGTGATCAACTCGAGTTGATCACAGCAGTCTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-963s1c1
Sequence:CCGGCCAAGTGAGAGTTATTTGCAACTCGAGTTGCAAATAACTCTCACTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024841.4-1692s21c1
Sequence:CCGGTGTAGTGACCAGTTGCCTAATCTCGAGATTAGGCAACTGGTCACTACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024841.4-581s21c1
Sequence:CCGGTGCAAAGCAACGAGCTCTATGCTCGAGCATAGAGCTCGTTGCTTTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024841
PRR5L MISSION shRNA shRNA Plasmid DNA
proline rich 5 like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-603s1c1
Sequence:CCGGCGGCTGTTGAAGAGTGAACTTCTCGAGAAGTTCACTCTTCAACAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000136523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-1143s1c1
Sequence:CCGGCCACTGAATGAGATGGTCTTGCTCGAGCAAGACCATCTCATTCAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-611s1c1
Sequence:CCGGGAAGAGTGAACTTGGATCATTCTCGAGAATGATCCAAGTTCACTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-614s1c1
Sequence:CCGGGAGTGAACTTGGATCATTCATCTCGAGATGAATGATCCAAGTTCACTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-962s1c1
Sequence:CCGGCCCAAGTGAGAGTTATTTGCACTCGAGTGCAAATAACTCTCACTTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024841.4-1573s21c1
Sequence:CCGGTATGCGATGCTGCCTTATTTCCTCGAGGAAATAAGGCAGCATCGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-521s1c1
Sequence:CCGGCGTTCAGACTGCTGTGATCAACTCGAGTTGATCACAGCAGTCTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-963s1c1
Sequence:CCGGCCAAGTGAGAGTTATTTGCAACTCGAGTTGCAAATAACTCTCACTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024841.4-1692s21c1
Sequence:CCGGTGTAGTGACCAGTTGCCTAATCTCGAGATTAGGCAACTGGTCACTACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000432357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024841.4-581s21c1
Sequence:CCGGTGCAAAGCAACGAGCTCTATGCTCGAGCATAGAGCTCGTTGCTTTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024841
PRR5L MISSION shRNA Lentiviral Transduction Particles
proline rich 5 like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137272    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-603s1c1
Sequence:CCGGCGGCTGTTGAAGAGTGAACTTCTCGAGAAGTTCACTCTTCAACAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000136523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-1143s1c1
Sequence:CCGGCCACTGAATGAGATGGTCTTGCTCGAGCAAGACCATCTCATTCAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-611s1c1
Sequence:CCGGGAAGAGTGAACTTGGATCATTCTCGAGAATGATCCAAGTTCACTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-614s1c1
Sequence:CCGGGAGTGAACTTGGATCATTCATCTCGAGATGAATGATCCAAGTTCACTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-962s1c1
Sequence:CCGGCCCAAGTGAGAGTTATTTGCACTCGAGTGCAAATAACTCTCACTTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436439    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024841.4-1573s21c1
Sequence:CCGGTATGCGATGCTGCCTTATTTCCTCGAGGAAATAAGGCAGCATCGCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-521s1c1
Sequence:CCGGCGTTCAGACTGCTGTGATCAACTCGAGTTGATCACAGCAGTCTGAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024841.2-963s1c1
Sequence:CCGGCCAAGTGAGAGTTATTTGCAACTCGAGTTGCAAATAACTCTCACTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416352    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024841.4-1692s21c1
Sequence:CCGGTGTAGTGACCAGTTGCCTAATCTCGAGATTAGGCAACTGGTCACTACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000432357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024841.4-581s21c1
Sequence:CCGGTGCAAAGCAACGAGCTCTATGCTCGAGCATAGAGCTCGTTGCTTTGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175181
PRR5L MISSION shRNA Bacterial Glycerol Stock
proline rich 5 like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-999s1c1
Sequence:CCGGCAAGGTGACTGTCCTGAACTACTCGAGTAGTTCAGGACAGTCACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-474s1c2
Sequence:CCGGCAATGAGCTGTATGCACTGAACTCGAGTTCAGTGCATACAGCTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.5-611s1c1
Sequence:CCGGGTGAACTTGGATCATTCATTACTCGAGTAATGAATGATCCAAGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175181.3-1933s1c1
Sequence:CCGGGCTGTCTACATCATGAGCTTTCTCGAGAAAGCTCATGATGTAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-804s1c1
Sequence:CCGGCAAGTTGCCTTCTTCTGTTATCTCGAGATAACAGAAGAAGGCAACTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175181.3-1860s1c1
Sequence:CCGGGCAGAGTTACTGGGAAATCATCTCGAGATGATTTCCCAGTAACTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-544s1c1
Sequence:CCGGGACTATTTCCAGAACCAGCTTCTCGAGAAGCTGGTTCTGGAAATAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175181
PRR5L MISSION shRNA shRNA Plasmid DNA
proline rich 5 like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-999s1c1
Sequence:CCGGCAAGGTGACTGTCCTGAACTACTCGAGTAGTTCAGGACAGTCACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-474s1c2
Sequence:CCGGCAATGAGCTGTATGCACTGAACTCGAGTTCAGTGCATACAGCTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.5-611s1c1
Sequence:CCGGGTGAACTTGGATCATTCATTACTCGAGTAATGAATGATCCAAGTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175181.3-1933s1c1
Sequence:CCGGGCTGTCTACATCATGAGCTTTCTCGAGAAAGCTCATGATGTAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000174406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-804s1c1
Sequence:CCGGCAAGTTGCCTTCTTCTGTTATCTCGAGATAACAGAAGAAGGCAACTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175181.3-1860s1c1
Sequence:CCGGGCAGAGTTACTGGGAAATCATCTCGAGATGATTTCCCAGTAACTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000176062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-544s1c1
Sequence:CCGGGACTATTTCCAGAACCAGCTTCTCGAGAAGCTGGTTCTGGAAATAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175181
PRR5L MISSION shRNA Lentiviral Transduction Particles
proline rich 5 like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173760    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-999s1c1
Sequence:CCGGCAAGGTGACTGTCCTGAACTACTCGAGTAGTTCAGGACAGTCACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-474s1c2
Sequence:CCGGCAATGAGCTGTATGCACTGAACTCGAGTTCAGTGCATACAGCTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.5-611s1c1
Sequence:CCGGGTGAACTTGGATCATTCATTACTCGAGTAATGAATGATCCAAGTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175181.3-1933s1c1
Sequence:CCGGGCTGTCTACATCATGAGCTTTCTCGAGAAAGCTCATGATGTAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000174406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-804s1c1
Sequence:CCGGCAAGTTGCCTTCTTCTGTTATCTCGAGATAACAGAAGAAGGCAACTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175740    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175181.3-1860s1c1
Sequence:CCGGGCAGAGTTACTGGGAAATCATCTCGAGATGATTTCCCAGTAACTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000176062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175181.3-544s1c1
Sequence:CCGGGACTATTTCCAGAACCAGCTTCTCGAGAAGCTGGTTCTGGAAATAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)