EMAIL THIS PAGE TO A FRIEND

PRR9

proline rich 9

17 Gene Product Result for
UniProtKB ID: Q5T870
Gene ID:
Mouse(109314) proline rich 9
Rat(100361314) proline rich 9
Thale Cress(819292) two-component response regulator-like APRR9
domestic cat(101088866) proline rich 9
naked mole-rat(101718452) proline rich 9
cow(100296489) proline rich 9
sheep(101103107) proline rich 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171182 predicted 480
2 SASI_Mm01_00171183 predicted 348
3 SASI_Mm01_00171184 predicted 623
4 SASI_Mm01_00171186 predicted 513
5 SASI_Mm01_00171187 predicted 613
6 SASI_Mm01_00171188 predicted 420
7 SASI_Mm01_00171189 predicted 624
8 SASI_Mm01_00171190 predicted 649
9 SASI_Mm01_00171191 predicted 544
10 SASI_Mm02_00346299 predicted 546
11 SASI_Mm01_00171185 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175424
PRR9 MISSION shRNA Bacterial Glycerol Stock
proline rich 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175424.2-483s1c1
Sequence:CCGGCCTGTGGGTATCTCTGTGTAACTCGAGTTACACAGAGATACCCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175424.2-258s1c1
Sequence:CCGGCAAGGCCAAGATCCATGTCTACTCGAGTAGACATGGATCTTGGCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175424.2-1020s1c1
Sequence:CCGGGCTTTGTAGATGATCTGCTTTCTCGAGAAAGCAGATCATCTACAAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175424.2-192s1c1
Sequence:CCGGCCACAACAAGCTCAGGAAGTACTCGAGTACTTCCTGAGCTTGTTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175424.2-216s1c1
Sequence:CCGGGTTTCTCAGTGCCAGGAGTTACTCGAGTAACTCCTGGCACTGAGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175424
PRR9 MISSION shRNA shRNA Plasmid DNA
proline rich 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175424.2-483s1c1
Sequence:CCGGCCTGTGGGTATCTCTGTGTAACTCGAGTTACACAGAGATACCCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175424.2-258s1c1
Sequence:CCGGCAAGGCCAAGATCCATGTCTACTCGAGTAGACATGGATCTTGGCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175424.2-1020s1c1
Sequence:CCGGGCTTTGTAGATGATCTGCTTTCTCGAGAAAGCAGATCATCTACAAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175424.2-192s1c1
Sequence:CCGGCCACAACAAGCTCAGGAAGTACTCGAGTACTTCCTGAGCTTGTTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175424.2-216s1c1
Sequence:CCGGGTTTCTCAGTGCCAGGAGTTACTCGAGTAACTCCTGGCACTGAGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175424
PRR9 MISSION shRNA Lentiviral Transduction Particles
proline rich 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195972    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175424.2-483s1c1
Sequence:CCGGCCTGTGGGTATCTCTGTGTAACTCGAGTTACACAGAGATACCCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175424.2-258s1c1
Sequence:CCGGCAAGGCCAAGATCCATGTCTACTCGAGTAGACATGGATCTTGGCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179174    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175424.2-1020s1c1
Sequence:CCGGGCTTTGTAGATGATCTGCTTTCTCGAGAAAGCAGATCATCTACAAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175424.2-192s1c1
Sequence:CCGGCCACAACAAGCTCAGGAAGTACTCGAGTACTTCCTGAGCTTGTTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175424.2-216s1c1
Sequence:CCGGGTTTCTCAGTGCCAGGAGTTACTCGAGTAACTCCTGGCACTGAGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)