EMAIL THIS PAGE TO A FRIEND

PRRC2A

proline-rich coiled-coil 2A

68 Gene Product Result for
Synonyms: BAT2 D6S51 D6S51E G2
Gene ID:
Human(7916) Summary: A cluster of genes, BAT1-BAT5, has been localized in the vicinity of the genes for TNF alpha and TNF beta. These genes are all within the human major histocompatibility complex class III region. This gene has microsatellite repeats which are associated with the age-at-onset of insulin-dependent diabetes mellitus (IDDM) and possibly thought to be involved with the inflammatory process of pancreatic beta-cell destruction during the development of IDDM. This gene is also a candidate gene for the development of rheumatoid arthritis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Mouse(53761) proline-rich coiled-coil 2A
Rat(294250) proline-rich coiled-coil 2A
Zebrafish(394248) proline-rich coiled-coil 2A
domestic cat(101085887) proline-rich coiled-coil 2A
dog(481713) proline-rich coiled-coil 2A
domestic guinea pig(100733336) proline-rich coiled-coil 2A
naked mole-rat(101713090) proline-rich coiled-coil 2A
cow(538553) proline-rich coiled-coil 2A
sheep(101121634) proline-rich coiled-coil 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020027 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020027 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020027 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080686 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_004638 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004638 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004638 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU065391 MISSION® esiRNA esiRNA targeting mouse Bat2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004638 Rosetta Predictions human pricing
NM_080686 Rosetta Predictions human pricing
NM_212462 Rosetta Predictions rat pricing
NM_020027 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004638 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123289 predicted 6231
2 SASI_Hs01_00123290 predicted 4898
3 SASI_Hs01_00123291 predicted 3406
4 SASI_Hs01_00123292 predicted 4893
5 SASI_Hs01_00123293 predicted 4914
6 SASI_Hs01_00123294 predicted 841
7 SASI_Hs01_00123295 predicted 3745
8 SASI_Hs01_00123296 predicted 3754
9 SASI_Hs01_00123297 predicted 768
10 SASI_Hs01_00123298 predicted 1021
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00150138 predicted 6402
2 SASI_Hs01_00150139 predicted 5080
3 SASI_Hs01_00150140 predicted 3588
4 SASI_Hs01_00150141 predicted 5062
5 SASI_Hs01_00150142 predicted 5089
6 SASI_Hs01_00150143 predicted 982
7 SASI_Hs01_00150144 predicted 3919
8 SASI_Hs01_00150145 predicted 3925
9 SASI_Hs01_00150146 predicted 914
10 SASI_Hs02_00362477 predicted 322
11 SASI_Hs01_00150147 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084323 predicted 774
2 SASI_Rn01_00084324 predicted 6169
3 SASI_Rn01_00084325 predicted 3039
4 SASI_Rn01_00084326 predicted 664
5 SASI_Rn01_00084327 predicted 3029
6 SASI_Rn01_00084328 predicted 6261
7 SASI_Rn02_00270464 predicted 944
8 SASI_Rn01_00084329 predicted 3157
9 SASI_Rn01_00084330 predicted 930
10 SASI_Rn01_00084332 predicted 4839
11 SASI_Rn01_00084331 predicted 5301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020027 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325393 predicted 975
2 SASI_Mm01_00112064 predicted 5170
3 SASI_Mm01_00112065 predicted 1051
4 SASI_Mm01_00112066 predicted 538
5 SASI_Mm01_00112067 predicted 6314
6 SASI_Mm01_00112068 predicted 5580
7 SASI_Mm01_00112069 predicted 2949
8 SASI_Mm01_00112070 predicted 6372
9 SASI_Mm01_00112071 predicted 3802
10 SASI_Mm01_00112073 predicted 805
11 SASI_Mm01_00112072 predicted 731
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020027
VALIDATED
PRRC2A MISSION shRNA Bacterial Glycerol Stock
proline-rich coiled-coil 2A
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-3604s1c1
Sequence:CCGGCCAAGTAAAGAACCTTTGAAACTCGAGTTTCAAAGGTTCTTTACTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020027.2-6570s21c1
Sequence:CCGGGGGCTTGTATATAGATTATAACTCGAGTTATAATCTATATACAAGCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020027.2-2559s21c1
Sequence:CCGGCCACCTTATCTGGCTAATTATCTCGAGATAATTAGCCAGATAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-985s1c1
Sequence:CCGGGCCCATGAAGAGGTTGACTATCTCGAGATAGTCAACCTCTTCATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-3600s1c1
Sequence:CCGGGCCTCCAAGTAAAGAACCTTTCTCGAGAAAGGTTCTTTACTTGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-986s1c1
Sequence:CCGGCCCATGAAGAGGTTGACTATACTCGAGTATAGTCAACCTCTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020027.2-1051s21c1
Sequence:CCGGCCCATGAAGAGGTTGACTATACTCGAGTATAGTCAACCTCTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020027.2-125s21c1
Sequence:CCGGCAACCTGTTTGATACGTATAACTCGAGTTATACGTATCAAACAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020027.2-2900s21c1
Sequence:CCGGTCGAAGAGCTGGGCCTATAAACTCGAGTTTATAGGCCCAGCTCTTCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020027
VALIDATED
PRRC2A MISSION shRNA shRNA Plasmid DNA
proline-rich coiled-coil 2A
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-3604s1c1
Sequence:CCGGCCAAGTAAAGAACCTTTGAAACTCGAGTTTCAAAGGTTCTTTACTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020027.2-6570s21c1
Sequence:CCGGGGGCTTGTATATAGATTATAACTCGAGTTATAATCTATATACAAGCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020027.2-2559s21c1
Sequence:CCGGCCACCTTATCTGGCTAATTATCTCGAGATAATTAGCCAGATAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-985s1c1
Sequence:CCGGGCCCATGAAGAGGTTGACTATCTCGAGATAGTCAACCTCTTCATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-3600s1c1
Sequence:CCGGGCCTCCAAGTAAAGAACCTTTCTCGAGAAAGGTTCTTTACTTGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000099504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-986s1c1
Sequence:CCGGCCCATGAAGAGGTTGACTATACTCGAGTATAGTCAACCTCTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020027.2-1051s21c1
Sequence:CCGGCCCATGAAGAGGTTGACTATACTCGAGTATAGTCAACCTCTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020027.2-125s21c1
Sequence:CCGGCAACCTGTTTGATACGTATAACTCGAGTTATACGTATCAAACAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000245345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020027.2-2900s21c1
Sequence:CCGGTCGAAGAGCTGGGCCTATAAACTCGAGTTTATAGGCCCAGCTCTTCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020027
VALIDATED
PRRC2A MISSION shRNA Lentiviral Transduction Particles
proline-rich coiled-coil 2A
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-3604s1c1
Sequence:CCGGCCAAGTAAAGAACCTTTGAAACTCGAGTTTCAAAGGTTCTTTACTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020027.2-6570s21c1
Sequence:CCGGGGGCTTGTATATAGATTATAACTCGAGTTATAATCTATATACAAGCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020027.2-2559s21c1
Sequence:CCGGCCACCTTATCTGGCTAATTATCTCGAGATAATTAGCCAGATAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-985s1c1
Sequence:CCGGGCCCATGAAGAGGTTGACTATCTCGAGATAGTCAACCTCTTCATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-3600s1c1
Sequence:CCGGGCCTCCAAGTAAAGAACCTTTCTCGAGAAAGGTTCTTTACTTGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000099504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020027.1-986s1c1
Sequence:CCGGCCCATGAAGAGGTTGACTATACTCGAGTATAGTCAACCTCTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245344    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020027.2-1051s21c1
Sequence:CCGGCCCATGAAGAGGTTGACTATACTCGAGTATAGTCAACCTCTTCATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245343    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020027.2-125s21c1
Sequence:CCGGCAACCTGTTTGATACGTATAACTCGAGTTATACGTATCAAACAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000245345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020027.2-2900s21c1
Sequence:CCGGTCGAAGAGCTGGGCCTATAAACTCGAGTTTATAGGCCCAGCTCTTCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080686
PRRC2A MISSION shRNA Bacterial Glycerol Stock
proline-rich coiled-coil 2A
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-5071s21c1
Sequence:CCGGCCTCACATCTGGAACCGTTTACTCGAGTAAACGGTTCCAGATGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-5799s21c1
Sequence:CCGGGGGAGCCATGGACTCTCAATTCTCGAGAATTGAGAGTCCATGGCTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-1163s21c1
Sequence:CCGGCTATTCTCAAAGAGGATAATCCTCGAGGATTATCCTCTTTGAGAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-3410s21c1
Sequence:CCGGTCCGCAGTTACCGAGAGTTTCCTCGAGGAAACTCTCGGTAACTGCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-4325s21c1
Sequence:CCGGGTGGAGCCGTACCAGGTATTTCTCGAGAAATACCTGGTACGGCTCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080686
PRRC2A MISSION shRNA shRNA Plasmid DNA
proline-rich coiled-coil 2A
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-5071s21c1
Sequence:CCGGCCTCACATCTGGAACCGTTTACTCGAGTAAACGGTTCCAGATGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-5799s21c1
Sequence:CCGGGGGAGCCATGGACTCTCAATTCTCGAGAATTGAGAGTCCATGGCTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-1163s21c1
Sequence:CCGGCTATTCTCAAAGAGGATAATCCTCGAGGATTATCCTCTTTGAGAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-3410s21c1
Sequence:CCGGTCCGCAGTTACCGAGAGTTTCCTCGAGGAAACTCTCGGTAACTGCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000236163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-4325s21c1
Sequence:CCGGGTGGAGCCGTACCAGGTATTTCTCGAGAAATACCTGGTACGGCTCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080686
PRRC2A MISSION shRNA Lentiviral Transduction Particles
proline-rich coiled-coil 2A
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-5071s21c1
Sequence:CCGGCCTCACATCTGGAACCGTTTACTCGAGTAAACGGTTCCAGATGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-5799s21c1
Sequence:CCGGGGGAGCCATGGACTCTCAATTCTCGAGAATTGAGAGTCCATGGCTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-1163s21c1
Sequence:CCGGCTATTCTCAAAGAGGATAATCCTCGAGGATTATCCTCTTTGAGAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-3410s21c1
Sequence:CCGGTCCGCAGTTACCGAGAGTTTCCTCGAGGAAACTCTCGGTAACTGCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000236163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080686.2-4325s21c1
Sequence:CCGGGTGGAGCCGTACCAGGTATTTCTCGAGAAATACCTGGTACGGCTCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004638
PRRC2A MISSION shRNA Bacterial Glycerol Stock
proline-rich coiled-coil 2A
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000184389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004638.2-155s1c1
Sequence:CCGGCCTCGCTCAACCTGTTTGATACTCGAGTATCAAACAGGTTGAGCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004638.2-5497s1c1
Sequence:CCGGCCACAATCCAAGAACCTGGATCTCGAGATCCAGGTTCTTGGATTGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004638
PRRC2A MISSION shRNA shRNA Plasmid DNA
proline-rich coiled-coil 2A
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000184389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004638.2-155s1c1
Sequence:CCGGCCTCGCTCAACCTGTTTGATACTCGAGTATCAAACAGGTTGAGCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004638.2-5497s1c1
Sequence:CCGGCCACAATCCAAGAACCTGGATCTCGAGATCCAGGTTCTTGGATTGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004638
PRRC2A MISSION shRNA Lentiviral Transduction Particles
proline-rich coiled-coil 2A
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000184389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004638.2-155s1c1
Sequence:CCGGCCTCGCTCAACCTGTTTGATACTCGAGTATCAAACAGGTTGAGCGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004638.2-5497s1c1
Sequence:CCGGCCACAATCCAAGAACCTGGATCTCGAGATCCAGGTTCTTGGATTGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)