EMAIL THIS PAGE TO A FRIEND

PRRC2C

proline-rich coiled-coil 2C

232 Gene Product Result for
Synonyms: BAT2-iso BAT2D1 BAT2L2 XTP2
Gene ID:
Mouse(226562) proline-rich coiled-coil 2C
Rat(360865) proline-rich coiled-coil 2C
Zebrafish(407633) proline-rich coiled-coil 2C
chicken(424393) proline-rich coiled-coil 2C
domestic cat(101087373) proline-rich coiled-coil 2C
dog(480075) proline-rich coiled-coil 2C
domestic guinea pig(100722559) proline-rich coiled-coil 2C
naked mole-rat(101706043) proline-rich coiled-coil 2C
cow(505359) proline-rich coiled-coil 2C
sheep(101105586) proline-rich coiled-coil 2C
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015172 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015172 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015172 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081290 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081290 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081290 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015172 Rosetta Predictions human pricing
XM_341141 Rosetta Predictions rat pricing
NM_001081290 Rosetta Predictions mouse pricing
XM_148990 Rosetta Predictions mouse pricing
XM_886288 Rosetta Predictions mouse pricing
XM_896634 Rosetta Predictions mouse pricing
XM_896646 Rosetta Predictions mouse pricing
XM_896654 Rosetta Predictions mouse pricing
XM_976536 Rosetta Predictions mouse pricing
XM_976724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015172 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020192 predicted 6284
2 SASI_Hs01_00020193 predicted 5187
3 SASI_Hs02_00347176 predicted 3008
4 SASI_Hs01_00020195 predicted 7414
5 SASI_Hs01_00020196 predicted 7582
6 SASI_Hs01_00020197 predicted 3631
7 SASI_Hs01_00020198 predicted 5219
8 SASI_Hs01_00020199 predicted 6385
9 SASI_Hs01_00020200 predicted 6761
10 SASI_Hs01_00020201 predicted 1298
11 SASI_Hs01_00020194 predicted 3691
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341141 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392453 predicted 6123
2 SASI_Rn02_00392454 predicted 2591
3 SASI_Rn02_00392455 predicted 8801
4 SASI_Rn02_00392456 predicted 6552
5 SASI_Rn02_00392457 predicted 2768
6 SASI_Rn02_00392458 predicted 4171
7 SASI_Rn02_00392459 predicted 503
8 SASI_Rn02_00392460 predicted 4057
9 SASI_Rn02_00392461 predicted 6988
10 SASI_Rn02_00392462 predicted 7255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081290 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297021 predicted 6668
2 SASI_Mm02_00297022 predicted 4151
3 SASI_Mm02_00297023 predicted 1056
4 SASI_Mm02_00297024 predicted 1251
5 SASI_Mm02_00297025 predicted 6265
6 SASI_Mm02_00297026 predicted 8817
7 SASI_Mm02_00297027 predicted 4132
8 SASI_Mm02_00297028 predicted 4136
9 SASI_Mm02_00297029 predicted 5023
10 SASI_Mm02_00297030 predicted 7693
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_148990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229922 predicted 6670
2 SASI_Mm01_00229923 predicted 1054
3 SASI_Mm01_00229924 predicted 1258
4 SASI_Mm01_00229925 predicted 6266
5 SASI_Mm01_00229926 predicted 4141
6 SASI_Mm01_00229927 predicted 4141
7 SASI_Mm01_00229928 predicted 5034
8 SASI_Mm01_00229929 predicted 7695
9 SASI_Mm01_00229930 predicted 7231
10 SASI_Mm01_00229931 predicted 2730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886288 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235946 predicted 6675
2 SASI_Mm01_00235947 predicted 1059
3 SASI_Mm01_00235948 predicted 1251
4 SASI_Mm01_00235949 predicted 6262
5 SASI_Mm01_00235950 predicted 8827
6 SASI_Mm01_00235951 predicted 4135
7 SASI_Mm01_00235952 predicted 4144
8 SASI_Mm01_00235953 predicted 7702
9 SASI_Mm01_00235954 predicted 7224
10 SASI_Mm01_00235955 predicted 2735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245045 predicted 467
2 SASI_Mm01_00245046 predicted 465
3 SASI_Mm01_00245047 predicted 495
4 SASI_Mm01_00245048 predicted 415
5 SASI_Mm01_00245049 predicted 416
6 SASI_Mm01_00245050 predicted 432
7 SASI_Mm01_00245051 predicted 507
8 SASI_Mm01_00245052 predicted 401
9 SASI_Mm01_00245053 predicted 493
10 SASI_Mm01_00245054 predicted 324
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896646 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00251364 predicted 6670
2 SASI_Mm01_00251365 predicted 1053
3 SASI_Mm01_00251366 predicted 1255
4 SASI_Mm01_00251367 predicted 6266
5 SASI_Mm01_00251368 predicted 4143
6 SASI_Mm01_00251369 predicted 4144
7 SASI_Mm01_00251370 predicted 5024
8 SASI_Mm01_00251371 predicted 7701
9 SASI_Mm01_00251372 predicted 7226
10 SASI_Mm01_00251373 predicted 2737
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896654 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231470 predicted 3040
2 SASI_Mm01_00231471 predicted 6671
3 SASI_Mm01_00231472 predicted 6099
4 SASI_Mm01_00231473 predicted 1054
5 SASI_Mm01_00231474 predicted 1256
6 SASI_Mm01_00231475 predicted 6263
7 SASI_Mm01_00231476 predicted 4140
8 SASI_Mm01_00231477 predicted 4142
9 SASI_Mm01_00231478 predicted 5033
10 SASI_Mm01_00231479 predicted 2735
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00245035 predicted 3037
2 SASI_Mm01_00245036 predicted 6671
3 SASI_Mm01_00245037 predicted 6095
4 SASI_Mm01_00245038 predicted 1059
5 SASI_Mm01_00245039 predicted 1259
6 SASI_Mm01_00245040 predicted 6271
7 SASI_Mm01_00245041 predicted 4135
8 SASI_Mm01_00245042 predicted 4142
9 SASI_Mm01_00245043 predicted 5027
10 SASI_Mm01_00245044 predicted 2738
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_976724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00238887 predicted 6669
2 SASI_Mm01_00238888 predicted 1054
3 SASI_Mm01_00238889 predicted 1257
4 SASI_Mm01_00238890 predicted 6272
5 SASI_Mm01_00238891 predicted 8585
6 SASI_Mm01_00238892 predicted 4141
7 SASI_Mm01_00238893 predicted 4144
8 SASI_Mm01_00238894 predicted 7698
9 SASI_Mm01_00238895 predicted 7233
10 SASI_Mm01_00238896 predicted 2739
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015172
VALIDATED
PRRC2C MISSION shRNA Bacterial Glycerol Stock
proline-rich coiled-coil 2C
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-9349s1c1
Sequence:CCGGGCATCCTTGAACCATATCAAACTCGAGTTTGATATGGTTCAAGGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-10209s1c1
Sequence:CCGGCCCGGTTTACTGTGTTGAGTTCTCGAGAACTCAACACAGTAAACCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-7390s1c1
Sequence:CCGGCGCAAGTTTATGTGTCTCAGTCTCGAGACTGAGACACATAAACTTGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-3614s1c1
Sequence:CCGGGCCTGCAGTTAAGACTGTAAACTCGAGTTTACAGTCTTAACTGCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-2236s1c1
Sequence:CCGGCGGCTGTATTATCTGGCTATTCTCGAGAATAGCCAGATAATACAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-8164s1c1
Sequence:CCGGGCCAGCCTTTCAGAGGATTAACTCGAGTTAATCCTCTGAAAGGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-8003s1c1
Sequence:CCGGCCAGCAGGTTACAGTACCTTTCTCGAGAAAGGTACTGTAACCTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-4933s1c1
Sequence:CCGGGCAACAATGGTCCACCCAAATCTCGAGATTTGGGTGGACCATTGTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-768s1c1
Sequence:CCGGCCCAGTTTACGTCCACCAAATCTCGAGATTTGGTGGACGTAAACTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-4933s21c1
Sequence:CCGGGCAACAATGGTCCACCCAAATCTCGAGATTTGGGTGGACCATTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-3614s21c1
Sequence:CCGGGCCTGCAGTTAAGACTGTAAACTCGAGTTTACAGTCTTAACTGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-8164s21c1
Sequence:CCGGGCCAGCCTTTCAGAGGATTAACTCGAGTTAATCCTCTGAAAGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-4632s1c1
Sequence:CCGGCCCACAAATGGCACAGTTAATCTCGAGATTAACTGTGCCATTTGTGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-9316s1c1
Sequence:CCGGCCTGGATGAATGAGCAGATAACTCGAGTTATCTGCTCATTCATCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-2799s1c1
Sequence:CCGGGCTGCTTATTCTGTAGAACATCTCGAGATGTTCTACAGAATAAGCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-8003s21c1
Sequence:CCGGCCAGCAGGTTACAGTACCTTTCTCGAGAAAGGTACTGTAACCTGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015172.3-9350s21c1
Sequence:CCGGGCATCCTTGAACCATATCAAACTCGAGTTTGATATGGTTCAAGGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015172
VALIDATED
PRRC2C MISSION shRNA shRNA Plasmid DNA
proline-rich coiled-coil 2C
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-9349s1c1
Sequence:CCGGGCATCCTTGAACCATATCAAACTCGAGTTTGATATGGTTCAAGGATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-10209s1c1
Sequence:CCGGCCCGGTTTACTGTGTTGAGTTCTCGAGAACTCAACACAGTAAACCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-7390s1c1
Sequence:CCGGCGCAAGTTTATGTGTCTCAGTCTCGAGACTGAGACACATAAACTTGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000142283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-3614s1c1
Sequence:CCGGGCCTGCAGTTAAGACTGTAAACTCGAGTTTACAGTCTTAACTGCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-2236s1c1
Sequence:CCGGCGGCTGTATTATCTGGCTATTCTCGAGAATAGCCAGATAATACAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-8164s1c1
Sequence:CCGGGCCAGCCTTTCAGAGGATTAACTCGAGTTAATCCTCTGAAAGGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-8003s1c1
Sequence:CCGGCCAGCAGGTTACAGTACCTTTCTCGAGAAAGGTACTGTAACCTGCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000140164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-4933s1c1
Sequence:CCGGGCAACAATGGTCCACCCAAATCTCGAGATTTGGGTGGACCATTGTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000139677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-768s1c1
Sequence:CCGGCCCAGTTTACGTCCACCAAATCTCGAGATTTGGTGGACGTAAACTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-4933s21c1
Sequence:CCGGGCAACAATGGTCCACCCAAATCTCGAGATTTGGGTGGACCATTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-3614s21c1
Sequence:CCGGGCCTGCAGTTAAGACTGTAAACTCGAGTTTACAGTCTTAACTGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-8164s21c1
Sequence:CCGGGCCAGCCTTTCAGAGGATTAACTCGAGTTAATCCTCTGAAAGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-4632s1c1
Sequence:CCGGCCCACAAATGGCACAGTTAATCTCGAGATTAACTGTGCCATTTGTGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000141560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-9316s1c1
Sequence:CCGGCCTGGATGAATGAGCAGATAACTCGAGTTATCTGCTCATTCATCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000143461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-2799s1c1
Sequence:CCGGGCTGCTTATTCTGTAGAACATCTCGAGATGTTCTACAGAATAAGCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-8003s21c1
Sequence:CCGGCCAGCAGGTTACAGTACCTTTCTCGAGAAAGGTACTGTAACCTGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015172.3-9350s21c1
Sequence:CCGGGCATCCTTGAACCATATCAAACTCGAGTTTGATATGGTTCAAGGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015172
VALIDATED
PRRC2C MISSION shRNA Lentiviral Transduction Particles
proline-rich coiled-coil 2C
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143109    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-9349s1c1
Sequence:CCGGGCATCCTTGAACCATATCAAACTCGAGTTTGATATGGTTCAAGGATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-10209s1c1
Sequence:CCGGCCCGGTTTACTGTGTTGAGTTCTCGAGAACTCAACACAGTAAACCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-7390s1c1
Sequence:CCGGCGCAAGTTTATGTGTCTCAGTCTCGAGACTGAGACACATAAACTTGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000142283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-3614s1c1
Sequence:CCGGGCCTGCAGTTAAGACTGTAAACTCGAGTTTACAGTCTTAACTGCAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-2236s1c1
Sequence:CCGGCGGCTGTATTATCTGGCTATTCTCGAGAATAGCCAGATAATACAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-8164s1c1
Sequence:CCGGGCCAGCCTTTCAGAGGATTAACTCGAGTTAATCCTCTGAAAGGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-8003s1c1
Sequence:CCGGCCAGCAGGTTACAGTACCTTTCTCGAGAAAGGTACTGTAACCTGCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000140164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-4933s1c1
Sequence:CCGGGCAACAATGGTCCACCCAAATCTCGAGATTTGGGTGGACCATTGTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000139677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-768s1c1
Sequence:CCGGCCCAGTTTACGTCCACCAAATCTCGAGATTTGGTGGACGTAAACTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343898    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-4933s21c1
Sequence:CCGGGCAACAATGGTCCACCCAAATCTCGAGATTTGGGTGGACCATTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-3614s21c1
Sequence:CCGGGCCTGCAGTTAAGACTGTAAACTCGAGTTTACAGTCTTAACTGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-8164s21c1
Sequence:CCGGGCCAGCCTTTCAGAGGATTAACTCGAGTTAATCCTCTGAAAGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-4632s1c1
Sequence:CCGGCCCACAAATGGCACAGTTAATCTCGAGATTAACTGTGCCATTTGTGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000141560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_015172.2-9316s1c1
Sequence:CCGGCCTGGATGAATGAGCAGATAACTCGAGTTATCTGCTCATTCATCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000143461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015172.2-2799s1c1
Sequence:CCGGGCTGCTTATTCTGTAGAACATCTCGAGATGTTCTACAGAATAAGCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015172.3-8003s21c1
Sequence:CCGGCCAGCAGGTTACAGTACCTTTCTCGAGAAAGGTACTGTAACCTGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343899    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015172.3-9350s21c1
Sequence:CCGGGCATCCTTGAACCATATCAAACTCGAGTTTGATATGGTTCAAGGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081290
VALIDATED
PRRC2C MISSION shRNA Bacterial Glycerol Stock
proline-rich coiled-coil 2C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-2861s21c1
Sequence:CCGGCCTCGCCATGTTGATACAAATCTCGAGATTTGTATCAACATGGCGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-9795s21c1
Sequence:CCGGTAAATTGTCTCCTCTAGTATTCTCGAGAATACTAGAGGAGACAATTTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081290.1-2177s21c1
Sequence:CCGGCAACCTCGACCTGGCTATTTCCTCGAGGAAATAGCCAGGTCGAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-1600s21c1
Sequence:CCGGAGTACCTGATAACGATGAAATCTCGAGATTTCATCGTTATCAGGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-2442s21c1
Sequence:CCGGATATGGATCCTCGAATGATATCTCGAGATATCATTCGAGGATCCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081290
VALIDATED
PRRC2C MISSION shRNA shRNA Plasmid DNA
proline-rich coiled-coil 2C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-2861s21c1
Sequence:CCGGCCTCGCCATGTTGATACAAATCTCGAGATTTGTATCAACATGGCGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-9795s21c1
Sequence:CCGGTAAATTGTCTCCTCTAGTATTCTCGAGAATACTAGAGGAGACAATTTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081290.1-2177s21c1
Sequence:CCGGCAACCTCGACCTGGCTATTTCCTCGAGGAAATAGCCAGGTCGAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-1600s21c1
Sequence:CCGGAGTACCTGATAACGATGAAATCTCGAGATTTCATCGTTATCAGGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000238735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-2442s21c1
Sequence:CCGGATATGGATCCTCGAATGATATCTCGAGATATCATTCGAGGATCCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081290
VALIDATED
PRRC2C MISSION shRNA Lentiviral Transduction Particles
proline-rich coiled-coil 2C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-2861s21c1
Sequence:CCGGCCTCGCCATGTTGATACAAATCTCGAGATTTGTATCAACATGGCGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238736    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-9795s21c1
Sequence:CCGGTAAATTGTCTCCTCTAGTATTCTCGAGAATACTAGAGGAGACAATTTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081290.1-2177s21c1
Sequence:CCGGCAACCTCGACCTGGCTATTTCCTCGAGGAAATAGCCAGGTCGAGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-1600s21c1
Sequence:CCGGAGTACCTGATAACGATGAAATCTCGAGATTTCATCGTTATCAGGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000238735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081290.1-2442s21c1
Sequence:CCGGATATGGATCCTCGAATGATATCTCGAGATATCATTCGAGGATCCATATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)