EMAIL THIS PAGE TO A FRIEND

PRRG1

proline rich Gla (G-carboxyglutamic acid) 1

331 Gene Product Result for
Synonyms: PRGP1
UniProtKB ID: O14668, B2R7A3, C9JXL7, D3DWA9, Q5JT66
Gene ID:
Human(5638) Summary: This gene encodes a vitamin K-dependent, gamma-carboxyglutamic acid (Gla)-containing, single-pass transmembrane protein. This protein contains a Gla domain at the N-terminus, preceded by a propeptide sequence required for post-translational gamma-carboxylation of specific glutamic acid residues by a vitamin K-dependent gamma-carboxylase. The C-terminus is proline-rich containing PPXY and PXXP motifs found in a variety of signaling and cytoskeletal proteins. This gene is highly expressed in the spinal cord. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(546336) proline rich Gla (G-carboxyglutamic acid) 1
Rat(363472) proline rich Gla (G-carboxyglutamic acid) 1
chicken(418582) proline rich Gla (G-carboxyglutamic acid) 1
dog(491821) proline rich Gla (G-carboxyglutamic acid) 1
cow(785916) proline rich Gla (G-carboxyglutamic acid) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000950 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000950 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000950 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001164275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000950 Rosetta Predictions human pricing
XM_001059223 Rosetta Predictions rat pricing
XM_343791 Rosetta Predictions rat pricing
XM_621045 Rosetta Predictions mouse pricing
XM_900515 Rosetta Predictions mouse pricing
XM_900525 Rosetta Predictions mouse pricing
XM_900528 Rosetta Predictions mouse pricing
XM_921217 Rosetta Predictions mouse pricing
XM_921230 Rosetta Predictions mouse pricing
XM_921242 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057959 predicted 814
2 SASI_Hs02_00303562 predicted 254
3 SASI_Hs01_00057960 predicted 404
4 SASI_Hs01_00057961 predicted 736
5 SASI_Hs02_00303563 predicted 465
6 SASI_Hs01_00057963 predicted 863
7 SASI_Hs01_00057965 predicted 747
8 SASI_Hs01_00057966 predicted 929
9 SASI_Hs01_00057967 predicted 983
10 SASI_Hs01_00057968 predicted 420
11 SASI_Hs01_00057962 predicted 391
12 SASI_Hs01_00057964 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059223 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292484 predicted 225
2 SASI_Rn02_00292485 predicted 262
3 SASI_Rn02_00292486 predicted 410
4 SASI_Rn02_00292487 predicted 358
5 SASI_Rn02_00292488 predicted 336
6 SASI_Rn02_00292489 predicted 349
7 SASI_Rn02_00292490 predicted 278
8 SASI_Rn02_00292491 predicted 376
9 SASI_Rn02_00292492 predicted 234
10 SASI_Rn02_00292493 predicted 228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343791 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396329 predicted 225
2 SASI_Rn02_00396330 predicted 263
3 SASI_Rn02_00396331 predicted 412
4 SASI_Rn02_00396332 predicted 363
5 SASI_Rn02_00396333 predicted 339
6 SASI_Rn02_00396334 predicted 349
7 SASI_Rn02_00396335 predicted 285
8 SASI_Rn02_00396336 predicted 372
9 SASI_Rn02_00396337 predicted 232
10 SASI_Rn02_00396338 predicted 221
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_621045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201934 predicted 1351
2 SASI_Mm01_00201935 predicted 1305
3 SASI_Mm01_00201937 predicted 1245
4 SASI_Mm01_00201938 predicted 1349
5 SASI_Mm01_00201939 predicted 432
6 SASI_Mm01_00201940 predicted 1179
7 SASI_Mm01_00201941 predicted 1310
8 SASI_Mm01_00201942 predicted 1311
9 SASI_Mm01_00201943 predicted 1157
10 SASI_Mm02_00427711 predicted 1263
11 SASI_Mm01_00201936 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00272843 predicted 233
2 SASI_Mm01_00272844 predicted 213
3 SASI_Mm01_00272845 predicted 233
4 SASI_Mm01_00272846 predicted 220
5 SASI_Mm01_00272847 predicted 235
6 SASI_Mm01_00272848 predicted 213
7 SASI_Mm01_00272849 predicted 216
8 SASI_Mm01_00272850 predicted 211
9 SASI_Mm01_00272851 predicted 224
10 SASI_Mm01_00272852 predicted 220
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242636 predicted 1257
2 SASI_Mm01_00242637 predicted 1212
3 SASI_Mm01_00242639 predicted 1155
4 SASI_Mm01_00242640 predicted 1263
5 SASI_Mm01_00242641 predicted 338
6 SASI_Mm01_00242642 predicted 1090
7 SASI_Mm01_00242643 predicted 1219
8 SASI_Mm01_00242644 predicted 1224
9 SASI_Mm01_00242645 predicted 1074
10 SASI_Mm02_00430109 predicted 1177
11 SASI_Mm01_00242638 predicted 495
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_900528 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208048 predicted 1283
2 SASI_Mm01_00208049 predicted 1240
3 SASI_Mm01_00208051 predicted 1177
4 SASI_Mm01_00208052 predicted 1281
5 SASI_Mm01_00208053 predicted 366
6 SASI_Mm01_00208054 predicted 1108
7 SASI_Mm01_00208055 predicted 1244
8 SASI_Mm01_00208056 predicted 1246
9 SASI_Mm01_00208057 predicted 1096
10 SASI_Mm02_00430110 predicted 1195
11 SASI_Mm01_00208050 predicted 515
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443001 predicted 1352
2 SASI_Mm02_00443002 predicted 1298
3 SASI_Mm02_00443003 predicted 1247
4 SASI_Mm02_00443004 predicted 1346
5 SASI_Mm02_00443005 predicted 432
6 SASI_Mm02_00443006 predicted 1176
7 SASI_Mm02_00443007 predicted 1307
8 SASI_Mm02_00443008 predicted 1316
9 SASI_Mm02_00443009 predicted 1161
10 SASI_Mm02_00443010 predicted 1265
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921230 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443011 predicted 1261
2 SASI_Mm02_00443012 predicted 1211
3 SASI_Mm02_00443013 predicted 1160
4 SASI_Mm02_00443014 predicted 1259
5 SASI_Mm02_00443015 predicted 339
6 SASI_Mm02_00443016 predicted 1084
7 SASI_Mm02_00443017 predicted 1218
8 SASI_Mm02_00443018 predicted 1229
9 SASI_Mm02_00443019 predicted 1071
10 SASI_Mm02_00443020 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_921242 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00443021 predicted 1286
2 SASI_Mm02_00443022 predicted 1235
3 SASI_Mm02_00443023 predicted 1177
4 SASI_Mm02_00443024 predicted 1283
5 SASI_Mm02_00443025 predicted 362
6 SASI_Mm02_00443026 predicted 1114
7 SASI_Mm02_00443027 predicted 1240
8 SASI_Mm02_00443028 predicted 1251
9 SASI_Mm02_00443029 predicted 1098
10 SASI_Mm02_00443030 predicted 1193
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000950
VALIDATED
PRRG1 MISSION shRNA Bacterial Glycerol Stock
proline rich Gla (G-carboxyglutamic acid) 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-387s1c1
Sequence:CCGGAGGAAGTGACTGGTTTCAGTTCTCGAGAACTGAAACCAGTCACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-711s1c1
Sequence:CCGGGAGGAGTGAAACAGAACCTCACTCGAGTGAGGTTCTGTTTCACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-598s1c1
Sequence:CCGGTCTCCAGGCTTTCTGGGATATCTCGAGATATCCCAGAAAGCCTGGAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-420s1c1
Sequence:CCGGTCCGTTAATCTTTGGCCTCTTCTCGAGAAGAGGCCAAAGATTAACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000950.1-244s1c1
Sequence:CCGGGAAATAAGACAGGGCAACATTCTCGAGAATGTTGCCCTGTCTTATTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-616s21c1
Sequence:CCGGTTTCCCTCAGCACCTTAATATCTCGAGATATTAAGGTGCTGAGGGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-799s21c1
Sequence:CCGGGAGGAGTGAAACAGAACCTCACTCGAGTGAGGTTCTGTTTCACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000950.2-475s21c1
Sequence:CCGGAGGAAGTGACTGGTTTCAGTTCTCGAGAACTGAAACCAGTCACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-508s21c1
Sequence:CCGGTCCGTTAATCTTTGGCCTCTTCTCGAGAAGAGGCCAAAGATTAACGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-1244s21c1
Sequence:CCGGCCATTAACTTCTACCTAAATCCTCGAGGATTTAGGTAGAAGTTAATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000950
VALIDATED
PRRG1 MISSION shRNA shRNA Plasmid DNA
proline rich Gla (G-carboxyglutamic acid) 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-387s1c1
Sequence:CCGGAGGAAGTGACTGGTTTCAGTTCTCGAGAACTGAAACCAGTCACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-711s1c1
Sequence:CCGGGAGGAGTGAAACAGAACCTCACTCGAGTGAGGTTCTGTTTCACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-598s1c1
Sequence:CCGGTCTCCAGGCTTTCTGGGATATCTCGAGATATCCCAGAAAGCCTGGAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-420s1c1
Sequence:CCGGTCCGTTAATCTTTGGCCTCTTCTCGAGAAGAGGCCAAAGATTAACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000950.1-244s1c1
Sequence:CCGGGAAATAAGACAGGGCAACATTCTCGAGAATGTTGCCCTGTCTTATTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-616s21c1
Sequence:CCGGTTTCCCTCAGCACCTTAATATCTCGAGATATTAAGGTGCTGAGGGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-799s21c1
Sequence:CCGGGAGGAGTGAAACAGAACCTCACTCGAGTGAGGTTCTGTTTCACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000950.2-475s21c1
Sequence:CCGGAGGAAGTGACTGGTTTCAGTTCTCGAGAACTGAAACCAGTCACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-508s21c1
Sequence:CCGGTCCGTTAATCTTTGGCCTCTTCTCGAGAAGAGGCCAAAGATTAACGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-1244s21c1
Sequence:CCGGCCATTAACTTCTACCTAAATCCTCGAGGATTTAGGTAGAAGTTAATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000950
VALIDATED
PRRG1 MISSION shRNA Lentiviral Transduction Particles
proline rich Gla (G-carboxyglutamic acid) 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-387s1c1
Sequence:CCGGAGGAAGTGACTGGTTTCAGTTCTCGAGAACTGAAACCAGTCACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-711s1c1
Sequence:CCGGGAGGAGTGAAACAGAACCTCACTCGAGTGAGGTTCTGTTTCACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-598s1c1
Sequence:CCGGTCTCCAGGCTTTCTGGGATATCTCGAGATATCCCAGAAAGCCTGGAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_000950.1-420s1c1
Sequence:CCGGTCCGTTAATCTTTGGCCTCTTCTCGAGAAGAGGCCAAAGATTAACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000950.1-244s1c1
Sequence:CCGGGAAATAAGACAGGGCAACATTCTCGAGAATGTTGCCCTGTCTTATTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-616s21c1
Sequence:CCGGTTTCCCTCAGCACCTTAATATCTCGAGATATTAAGGTGCTGAGGGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-799s21c1
Sequence:CCGGGAGGAGTGAAACAGAACCTCACTCGAGTGAGGTTCTGTTTCACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000950.2-475s21c1
Sequence:CCGGAGGAAGTGACTGGTTTCAGTTCTCGAGAACTGAAACCAGTCACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-508s21c1
Sequence:CCGGTCCGTTAATCTTTGGCCTCTTCTCGAGAAGAGGCCAAAGATTAACGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296309    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000950.2-1244s21c1
Sequence:CCGGCCATTAACTTCTACCTAAATCCTCGAGGATTTAGGTAGAAGTTAATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164275
PRRG1 MISSION shRNA Bacterial Glycerol Stock
proline rich Gla (G-carboxyglutamic acid) 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-755s21c1
Sequence:CCGGCTGTGGTCACCACCATCAAATCTCGAGATTTGATGGTGGTGACCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164275.1-1089s21c1
Sequence:CCGGTCTACCACATCACCCATAAAGCTCGAGCTTTATGGGTGATGTGGTAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-342s21c1
Sequence:CCGGAGGAAGTGACTGGTTTCAATTCTCGAGAATTGAAACCAGTCACTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-688s21c1
Sequence:CCGGTTAGACCCACCACCAGAATATCTCGAGATATTCTGGTGGTGGGTCTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-481s21c1
Sequence:CCGGCCTTTCCCTCAGCAACTTAACCTCGAGGTTAAGTTGCTGAGGGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164275
PRRG1 MISSION shRNA shRNA Plasmid DNA
proline rich Gla (G-carboxyglutamic acid) 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-755s21c1
Sequence:CCGGCTGTGGTCACCACCATCAAATCTCGAGATTTGATGGTGGTGACCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164275.1-1089s21c1
Sequence:CCGGTCTACCACATCACCCATAAAGCTCGAGCTTTATGGGTGATGTGGTAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-342s21c1
Sequence:CCGGAGGAAGTGACTGGTTTCAATTCTCGAGAATTGAAACCAGTCACTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-688s21c1
Sequence:CCGGTTAGACCCACCACCAGAATATCTCGAGATATTCTGGTGGTGGGTCTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-481s21c1
Sequence:CCGGCCTTTCCCTCAGCAACTTAACCTCGAGGTTAAGTTGCTGAGGGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164275
PRRG1 MISSION shRNA Lentiviral Transduction Particles
proline rich Gla (G-carboxyglutamic acid) 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-755s21c1
Sequence:CCGGCTGTGGTCACCACCATCAAATCTCGAGATTTGATGGTGGTGACCACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367346    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001164275.1-1089s21c1
Sequence:CCGGTCTACCACATCACCCATAAAGCTCGAGCTTTATGGGTGATGTGGTAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-342s21c1
Sequence:CCGGAGGAAGTGACTGGTTTCAATTCTCGAGAATTGAAACCAGTCACTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-688s21c1
Sequence:CCGGTTAGACCCACCACCAGAATATCTCGAGATATTCTGGTGGTGGGTCTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367272    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164275.1-481s21c1
Sequence:CCGGCCTTTCCCTCAGCAACTTAACCTCGAGGTTAAGTTGCTGAGGGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)