EMAIL THIS PAGE TO A FRIEND

PRRT1

proline-rich transmembrane protein 1

68 Gene Product Result for
Synonyms: C6orf31 DSPD1 IFITMD7 NG5
Gene ID:
Mouse(260297) proline-rich transmembrane protein 1
Rat(406167) proline-rich transmembrane protein 1
Zebrafish(559734) proline-rich transmembrane protein 1
dog(607660) proline-rich transmembrane protein 1
domestic cat(101095337) proline-rich transmembrane protein 1
cow(617717) proline-rich transmembrane protein 1
sheep(100820743) proline-rich transmembrane protein 1
domestic guinea pig(100726673) proline-rich transmembrane protein 1
naked mole-rat(101713326) proline-rich transmembrane protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030651 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030890 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030890 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030890 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030651 Rosetta Predictions human pricing
XM_001060070 Rosetta Predictions rat pricing
NM_030890 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068097 predicted 819
2 SASI_Hs01_00068098 predicted 1447
3 SASI_Hs01_00068099 predicted 1141
4 SASI_Hs01_00068100 predicted 1014
5 SASI_Hs01_00068101 predicted 1143
6 SASI_Hs01_00068102 predicted 919
7 SASI_Hs01_00068103 predicted 1189
8 SASI_Hs02_00358230 predicted 821
9 SASI_Hs01_00068104 predicted 1502
10 SASI_Hs01_00068105 predicted 1329
11 SASI_Hs01_00068106 predicted 1203
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060070 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00295262 predicted 1503
2 SASI_Rn02_00295263 predicted 918
3 SASI_Rn02_00295264 predicted 1015
4 SASI_Rn02_00295265 predicted 921
5 SASI_Rn02_00295266 predicted 1021
6 SASI_Rn02_00295267 predicted 1013
7 SASI_Rn02_00295268 predicted 1287
8 SASI_Rn02_00295269 predicted 999
9 SASI_Rn02_00295270 predicted 868
10 SASI_Rn02_00295271 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150070 predicted 615
2 SASI_Mm01_00150071 predicted 506
3 SASI_Mm01_00150072 predicted 513
4 SASI_Mm01_00150073 predicted 424
5 SASI_Mm01_00150074 predicted 646
6 SASI_Mm02_00336965 predicted 502
7 SASI_Mm01_00150075 predicted 524
8 SASI_Mm01_00150076 predicted 671
9 SASI_Mm01_00150077 predicted 648
10 SASI_Mm01_00150078 predicted 643
11 SASI_Mm01_00150079 predicted 700
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030651
PRRT1 MISSION shRNA Bacterial Glycerol Stock
proline-rich transmembrane protein 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1596s1c1
Sequence:CCGGCACCCAGGTATCTGCCTATTTCTCGAGAAATAGGCAGATACCTGGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030651.2-923s1c1
Sequence:CCGGGAACTTCTCCTTCATCTCCCTCTCGAGAGGGAGATGAAGGAGAAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149230    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1697s1c1
Sequence:CCGGGATAAGAAACCTGCCTGTAAACTCGAGTTTACAGGCAGGTTTCTTATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1710s1c1
Sequence:CCGGCCTGTAAACGCTCTGTAAATACTCGAGTATTTACAGAGCGTTTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1145s1c1
Sequence:CCGGCAGACTTGGATACATCGTAAACTCGAGTTTACGATGTATCCAAGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030651
PRRT1 MISSION shRNA shRNA Plasmid DNA
proline-rich transmembrane protein 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1596s1c1
Sequence:CCGGCACCCAGGTATCTGCCTATTTCTCGAGAAATAGGCAGATACCTGGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000184357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030651.2-923s1c1
Sequence:CCGGGAACTTCTCCTTCATCTCCCTCTCGAGAGGGAGATGAAGGAGAAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000149230    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1697s1c1
Sequence:CCGGGATAAGAAACCTGCCTGTAAACTCGAGTTTACAGGCAGGTTTCTTATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1710s1c1
Sequence:CCGGCCTGTAAACGCTCTGTAAATACTCGAGTATTTACAGAGCGTTTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000148483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1145s1c1
Sequence:CCGGCAGACTTGGATACATCGTAAACTCGAGTTTACGATGTATCCAAGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030651
PRRT1 MISSION shRNA Lentiviral Transduction Particles
proline-rich transmembrane protein 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195870    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1596s1c1
Sequence:CCGGCACCCAGGTATCTGCCTATTTCTCGAGAAATAGGCAGATACCTGGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000184357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030651.2-923s1c1
Sequence:CCGGGAACTTCTCCTTCATCTCCCTCTCGAGAGGGAGATGAAGGAGAAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000149230    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1697s1c1
Sequence:CCGGGATAAGAAACCTGCCTGTAAACTCGAGTTTACAGGCAGGTTTCTTATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148753    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1710s1c1
Sequence:CCGGCCTGTAAACGCTCTGTAAATACTCGAGTATTTACAGAGCGTTTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000148483    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030651.2-1145s1c1
Sequence:CCGGCAGACTTGGATACATCGTAAACTCGAGTTTACGATGTATCCAAGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030890
PRRT1 MISSION shRNA Bacterial Glycerol Stock
proline-rich transmembrane protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-711s21c1
Sequence:CCGGCACAGGCATCATCGCCATCTTCTCGAGAAGATGGCGATGATGCCTGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-213s21c1
Sequence:CCGGTCAACGCGGTCCTTCGTCTTCCTCGAGGAAGACGAAGGACCGCGTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-527s21c1
Sequence:CCGGCTGCTTATGTCCCTGTGTATCCTCGAGGATACACAGGGACATAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-329s21c1
Sequence:CCGGACCCTTATCTGCAGGAGACTCCTCGAGGAGTCTCCTGCAGATAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-134s21c1
Sequence:CCGGACCACCATTACCACCAGTCTGCTCGAGCAGACTGGTGGTAATGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030890
PRRT1 MISSION shRNA shRNA Plasmid DNA
proline-rich transmembrane protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-711s21c1
Sequence:CCGGCACAGGCATCATCGCCATCTTCTCGAGAAGATGGCGATGATGCCTGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-213s21c1
Sequence:CCGGTCAACGCGGTCCTTCGTCTTCCTCGAGGAAGACGAAGGACCGCGTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-527s21c1
Sequence:CCGGCTGCTTATGTCCCTGTGTATCCTCGAGGATACACAGGGACATAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-329s21c1
Sequence:CCGGACCCTTATCTGCAGGAGACTCCTCGAGGAGTCTCCTGCAGATAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-134s21c1
Sequence:CCGGACCACCATTACCACCAGTCTGCTCGAGCAGACTGGTGGTAATGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030890
PRRT1 MISSION shRNA Lentiviral Transduction Particles
proline-rich transmembrane protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-711s21c1
Sequence:CCGGCACAGGCATCATCGCCATCTTCTCGAGAAGATGGCGATGATGCCTGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233331    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-213s21c1
Sequence:CCGGTCAACGCGGTCCTTCGTCTTCCTCGAGGAAGACGAAGGACCGCGTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-527s21c1
Sequence:CCGGCTGCTTATGTCCCTGTGTATCCTCGAGGATACACAGGGACATAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233332    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-329s21c1
Sequence:CCGGACCCTTATCTGCAGGAGACTCCTCGAGGAGTCTCCTGCAGATAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030890.1-134s21c1
Sequence:CCGGACCACCATTACCACCAGTCTGCTCGAGCAGACTGGTGGTAATGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)