EMAIL THIS PAGE TO A FRIEND

PRRT2

proline-rich transmembrane protein 2

103 Gene Product Result for
Synonyms: BFIC2 BFIS2 DSPB3 DYT10 EKD1 ICCA IFITMD1 PKC
UniProtKB ID: Q7Z6L0, A8K8M8, Q8N2N8, Q8NAQ7, Q8ND36, Q96FA8
Gene ID:
Human(112476) Summary: This gene encodes a transmembrane protein containing a proline-rich domain in its N-terminal half. Studies in mice suggest that it is predominantly expressed in brain and spinal cord in embryonic and postnatal stages. Mutations in this gene are associated with episodic kinesigenic dyskinesia-1. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(69017) proline-rich transmembrane protein 2
Rat(361651) proline-rich transmembrane protein 2
naked mole-rat(101714916) proline-rich transmembrane protein 2
domestic guinea pig(100727070) proline-rich transmembrane protein 2
sheep(101119953) proline-rich transmembrane protein 2
dog(100686783) proline-rich transmembrane protein 2
domestic cat(101096627) proline-rich transmembrane protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145239 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145239 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145239 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145239 Rosetta Predictions human pricing
XM_001078254 Rosetta Predictions rat pricing
XM_341931 Rosetta Predictions rat pricing
NM_001102563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145239 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166899 predicted 1297
2 SASI_Hs01_00166900 predicted 348
3 SASI_Hs02_00365081 predicted 638
4 SASI_Hs01_00166901 predicted 1524
5 SASI_Hs01_00166902 predicted 1167
6 SASI_Hs01_00166903 predicted 598
7 SASI_Hs01_00166904 predicted 369
8 SASI_Hs01_00166905 predicted 603
9 SASI_Hs01_00166906 predicted 1495
10 SASI_Hs02_00365082 predicted 1293
11 SASI_Hs01_00166898 predicted 516
12 SASI_Hs01_00166907 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078254 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360126 predicted 735
2 SASI_Rn02_00360127 predicted 887
3 SASI_Rn02_00360128 predicted 824
4 SASI_Rn02_00360129 predicted 875
5 SASI_Rn02_00360130 predicted 1502
6 SASI_Rn02_00360131 predicted 1088
7 SASI_Rn02_00360132 predicted 462
8 SASI_Rn02_00360133 predicted 283
9 SASI_Rn02_00360134 predicted 364
10 SASI_Rn02_00360135 predicted 967
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00393573 predicted 645
2 SASI_Rn02_00393574 predicted 734
3 SASI_Rn02_00393575 predicted 357
4 SASI_Rn02_00393576 predicted 465
5 SASI_Rn02_00393577 predicted 286
6 SASI_Rn02_00393578 predicted 365
7 SASI_Rn02_00393579 predicted 353
8 SASI_Rn02_00393580 predicted 640
9 SASI_Rn02_00393581 predicted 360
10 SASI_Rn02_00393582 predicted 529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302933 predicted 1547
2 SASI_Mm02_00302934 predicted 883
3 SASI_Mm02_00302935 predicted 1493
4 SASI_Mm02_00302936 predicted 1659
5 SASI_Mm02_00302937 predicted 1065
6 SASI_Mm02_00302938 predicted 948
7 SASI_Mm02_00302939 predicted 710
8 SASI_Mm02_00302940 predicted 1357
9 SASI_Mm02_00302941 predicted 505
10 SASI_Mm02_00302942 predicted 1670
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145239
PRRT2 MISSION shRNA Bacterial Glycerol Stock
proline-rich transmembrane protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145239.2-1152s21c1
Sequence:CCGGACATCGTGGCCTTCGCTTATGCTCGAGCATAAGCGAAGGCCACGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145239.2-1762s21c1
Sequence:CCGGCTCAACCCTCAGTCCTCTCTTCTCGAGAAGAGAGGACTGAGGGTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145239.2-1231s21c1
Sequence:CCGGCCGGGTAGCCAAGCTCTTAAGCTCGAGCTTAAGAGCTTGGCTACCCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145239.2-967s21c1
Sequence:CCGGGGTTGAGGAGGATCGAATGAGCTCGAGCTCATTCGATCCTCCTCAACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145239.1-521s1c1
Sequence:CCGGCCAAACCAGAAGTGAGCAAAGCTCGAGCTTTGCTCACTTCTGGTTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145239.1-506s1c1
Sequence:CCGGGCCAAGAAACAGTGTCCAAACCTCGAGGTTTGGACACTGTTTCTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145239.1-1772s1c1
Sequence:CCGGCGTCACCGTTTACTCTGCAAACTCGAGTTTGCAGAGTAAACGGTGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145239.1-1189s1c1
Sequence:CCGGGTCATCAACTTAGGCGTGTATCTCGAGATACACGCCTAAGTTGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145239.1-1191s1c1
Sequence:CCGGCATCAACTTAGGCGTGTATAACTCGAGTTATACACGCCTAAGTTGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145239.1-1630s1c1
Sequence:CCGGCAACTTTCATTGTCTTGGCATCTCGAGATGCCAAGACAATGAAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145239.1-697s1c1
Sequence:CCGGGAGATTCTGTCTGAGAGTGTACTCGAGTACACTCTCAGACAGAATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145239.1-1188s1c1
Sequence:CCGGCGTCATCAACTTAGGCGTGTACTCGAGTACACGCCTAAGTTGATGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145239
PRRT2 MISSION shRNA shRNA Plasmid DNA
proline-rich transmembrane protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145239.2-1152s21c1
Sequence:CCGGACATCGTGGCCTTCGCTTATGCTCGAGCATAAGCGAAGGCCACGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000439618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145239.2-1762s21c1
Sequence:CCGGCTCAACCCTCAGTCCTCTCTTCTCGAGAAGAGAGGACTGAGGGTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145239.2-1231s21c1
Sequence:CCGGCCGGGTAGCCAAGCTCTTAAGCTCGAGCTTAAGAGCTTGGCTACCCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000437690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145239.2-967s21c1
Sequence:CCGGGGTTGAGGAGGATCGAATGAGCTCGAGCTCATTCGATCCTCCTCAACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145239.1-521s1c1
Sequence:CCGGCCAAACCAGAAGTGAGCAAAGCTCGAGCTTTGCTCACTTCTGGTTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000138131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145239.1-506s1c1
Sequence:CCGGGCCAAGAAACAGTGTCCAAACCTCGAGGTTTGGACACTGTTTCTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145239.1-1772s1c1
Sequence:CCGGCGTCACCGTTTACTCTGCAAACTCGAGTTTGCAGAGTAAACGGTGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145239.1-1189s1c1
Sequence:CCGGGTCATCAACTTAGGCGTGTATCTCGAGATACACGCCTAAGTTGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000133833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145239.1-1191s1c1
Sequence:CCGGCATCAACTTAGGCGTGTATAACTCGAGTTATACACGCCTAAGTTGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000134938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145239.1-1630s1c1
Sequence:CCGGCAACTTTCATTGTCTTGGCATCTCGAGATGCCAAGACAATGAAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000135977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145239.1-697s1c1
Sequence:CCGGGAGATTCTGTCTGAGAGTGTACTCGAGTACACTCTCAGACAGAATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000137660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145239.1-1188s1c1
Sequence:CCGGCGTCATCAACTTAGGCGTGTACTCGAGTACACGCCTAAGTTGATGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145239
PRRT2 MISSION shRNA Lentiviral Transduction Particles
proline-rich transmembrane protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145239.2-1152s21c1
Sequence:CCGGACATCGTGGCCTTCGCTTATGCTCGAGCATAAGCGAAGGCCACGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000439618    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145239.2-1762s21c1
Sequence:CCGGCTCAACCCTCAGTCCTCTCTTCTCGAGAAGAGAGGACTGAGGGTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145239.2-1231s21c1
Sequence:CCGGCCGGGTAGCCAAGCTCTTAAGCTCGAGCTTAAGAGCTTGGCTACCCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000437690    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145239.2-967s21c1
Sequence:CCGGGGTTGAGGAGGATCGAATGAGCTCGAGCTCATTCGATCCTCCTCAACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138227    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145239.1-521s1c1
Sequence:CCGGCCAAACCAGAAGTGAGCAAAGCTCGAGCTTTGCTCACTTCTGGTTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000138131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145239.1-506s1c1
Sequence:CCGGGCCAAGAAACAGTGTCCAAACCTCGAGGTTTGGACACTGTTTCTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145239.1-1772s1c1
Sequence:CCGGCGTCACCGTTTACTCTGCAAACTCGAGTTTGCAGAGTAAACGGTGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135366    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145239.1-1189s1c1
Sequence:CCGGGTCATCAACTTAGGCGTGTATCTCGAGATACACGCCTAAGTTGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000133833    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145239.1-1191s1c1
Sequence:CCGGCATCAACTTAGGCGTGTATAACTCGAGTTATACACGCCTAAGTTGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000134938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145239.1-1630s1c1
Sequence:CCGGCAACTTTCATTGTCTTGGCATCTCGAGATGCCAAGACAATGAAAGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000135977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145239.1-697s1c1
Sequence:CCGGGAGATTCTGTCTGAGAGTGTACTCGAGTACACTCTCAGACAGAATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000137660    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145239.1-1188s1c1
Sequence:CCGGCGTCATCAACTTAGGCGTGTACTCGAGTACACGCCTAAGTTGATGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)