EMAIL THIS PAGE TO A FRIEND

PRRT3

proline-rich transmembrane protein 3

61 Gene Product Result for
UniProtKB ID: Q5FWE3, Q49AD0, Q6UXY6, Q8NBC9
Gene ID:
Mouse(210673) proline-rich transmembrane protein 3
Rat(502873) proline-rich transmembrane protein 3
chicken(416053) proline-rich transmembrane protein 3
Horse(100058227) proline-rich transmembrane protein 3
domestic cat(101085360) proline-rich transmembrane protein 3
dog(484660) proline-rich transmembrane protein 3
cow(504853) proline-rich transmembrane protein 3
sheep(101123156) proline-rich transmembrane protein 3
domestic guinea pig(100729782) proline-rich transmembrane protein 3
naked mole-rat(101703763) proline-rich transmembrane protein 3
Domestic Rabbit(100346838) proline-rich transmembrane protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172487 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172487 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172487 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_207351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_207351 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_207351 Rosetta Predictions human pricing
NM_001109350 Rosetta Predictions rat pricing
NM_172487 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022503 predicted 809
2 SASI_Hs01_00022504 predicted 2584
3 SASI_Hs01_00022505 predicted 753
4 SASI_Hs01_00022506 predicted 441
5 SASI_Hs01_00022507 predicted 1049
6 SASI_Hs01_00022508 predicted 325
7 SASI_Hs01_00022509 predicted 2360
8 SASI_Hs02_00373907 predicted 1047
9 SASI_Hs02_00373908 predicted 2853
10 SASI_Hs02_00373909 predicted 525
11 SASI_Hs01_00022502 predicted 2248
12 SASI_Hs01_00022510 predicted 1235
13 SASI_Hs01_00022511 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109350 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247564 predicted 1740
2 SASI_Rn02_00247565 predicted 1681
3 SASI_Rn02_00247566 predicted 356
4 SASI_Rn02_00247567 predicted 1400
5 SASI_Rn02_00247568 predicted 317
6 SASI_Rn02_00247569 predicted 1557
7 SASI_Rn02_00247570 predicted 1129
8 SASI_Rn02_00247571 predicted 1201
9 SASI_Rn02_00247572 predicted 683
10 SASI_Rn02_00247573 predicted 1120
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172487 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035078 predicted 809
2 SASI_Mm01_00035079 predicted 304
3 SASI_Mm01_00035080 predicted 713
4 SASI_Mm01_00035081 predicted 360
5 SASI_Mm01_00035082 predicted 2292
6 SASI_Mm01_00035083 predicted 1343
7 SASI_Mm02_00344056 predicted 1902
8 SASI_Mm01_00035084 predicted 2345
9 SASI_Mm01_00035085 predicted 1713
10 SASI_Mm01_00035086 predicted 1946
11 SASI_Mm01_00035087 predicted 621
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172487
PRRT3 MISSION shRNA Bacterial Glycerol Stock
proline-rich transmembrane protein 3
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172487.3-3124s21c1
Sequence:CCGGACCTGTACCCTCTCCTCAATGCTCGAGCATTGAGGAGAGGGTACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-3080s21c1
Sequence:CCGGGCGCCTCTAGTGACACTATAGCTCGAGCTATAGTGTCACTAGAGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-714s21c1
Sequence:CCGGTAGGAACGAGGAGCTAATAATCTCGAGATTATTAGCTCCTCGTTCCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-2579s21c1
Sequence:CCGGGGCCACCGTCACCTATCAATTCTCGAGAATTGATAGGTGACGGTGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-2347s21c1
Sequence:CCGGGTTCCCGAGAGACCCAATAACCTCGAGGTTATTGGGTCTCTCGGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172487.1-307s1c1
Sequence:CCGGCCATCAGAGTCACAGACCTTTCTCGAGAAAGGTCTGTGACTCTGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172487
PRRT3 MISSION shRNA shRNA Plasmid DNA
proline-rich transmembrane protein 3
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172487.3-3124s21c1
Sequence:CCGGACCTGTACCCTCTCCTCAATGCTCGAGCATTGAGGAGAGGGTACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-3080s21c1
Sequence:CCGGGCGCCTCTAGTGACACTATAGCTCGAGCTATAGTGTCACTAGAGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-714s21c1
Sequence:CCGGTAGGAACGAGGAGCTAATAATCTCGAGATTATTAGCTCCTCGTTCCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-2579s21c1
Sequence:CCGGGGCCACCGTCACCTATCAATTCTCGAGAATTGATAGGTGACGGTGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-2347s21c1
Sequence:CCGGGTTCCCGAGAGACCCAATAACCTCGAGGTTATTGGGTCTCTCGGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000202154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172487.1-307s1c1
Sequence:CCGGCCATCAGAGTCACAGACCTTTCTCGAGAAAGGTCTGTGACTCTGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172487
PRRT3 MISSION shRNA Lentiviral Transduction Particles
proline-rich transmembrane protein 3
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172487.3-3124s21c1
Sequence:CCGGACCTGTACCCTCTCCTCAATGCTCGAGCATTGAGGAGAGGGTACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-3080s21c1
Sequence:CCGGGCGCCTCTAGTGACACTATAGCTCGAGCTATAGTGTCACTAGAGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-714s21c1
Sequence:CCGGTAGGAACGAGGAGCTAATAATCTCGAGATTATTAGCTCCTCGTTCCTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-2579s21c1
Sequence:CCGGGGCCACCGTCACCTATCAATTCTCGAGAATTGATAGGTGACGGTGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172487.3-2347s21c1
Sequence:CCGGGTTCCCGAGAGACCCAATAACCTCGAGGTTATTGGGTCTCTCGGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000202154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172487.1-307s1c1
Sequence:CCGGCCATCAGAGTCACAGACCTTTCTCGAGAAAGGTCTGTGACTCTGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207351
PRRT3 MISSION shRNA Bacterial Glycerol Stock
proline-rich transmembrane protein 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207351.2-3218s1c1
Sequence:CCGGCCGTGTCTTATGCGGAATACACTCGAGTGTATTCCGCATAAGACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-340s1c1
Sequence:CCGGGACAGTCACAGGAACTCTGATCTCGAGATCAGAGTTCCTGTGACTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.2-3034s1c1
Sequence:CCGGCCAGTGATACCATCGAGCTTTCTCGAGAAAGCTCGATGGTATCACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-470s1c1
Sequence:CCGGCAGTAACTGATGACCTCCAGACTCGAGTCTGGAGGTCATCAGTTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-342s1c1
Sequence:CCGGCAGTCACAGGAACTCTGATGTCTCGAGACATCAGAGTTCCTGTGACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-1344s1c1
Sequence:CCGGGCTCTGTCTAGTAACTGAGAACTCGAGTTCTCAGTTACTAGACAGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-582s1c1
Sequence:CCGGCCACCCTCATCTCACTTTCATCTCGAGATGAAAGTGAGATGAGGGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.2-2301s1c1
Sequence:CCGGGAGCGACCCAATAACTGCTATCTCGAGATAGCAGTTATTGGGTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-1265s1c1
Sequence:CCGGCAGCTGTAAACCGAACAGAGACTCGAGTCTCTGTTCGGTTTACAGCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-250s1c1
Sequence:CCGGGAAATCCCTATGATCCCTGGACTCGAGTCCAGGGATCATAGGGATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-1150s1c1
Sequence:CCGGCCAGAGAGAGCAGCAATGAATCTCGAGATTCATTGCTGCTCTCTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207351
PRRT3 MISSION shRNA shRNA Plasmid DNA
proline-rich transmembrane protein 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207351.2-3218s1c1
Sequence:CCGGCCGTGTCTTATGCGGAATACACTCGAGTGTATTCCGCATAAGACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-340s1c1
Sequence:CCGGGACAGTCACAGGAACTCTGATCTCGAGATCAGAGTTCCTGTGACTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.2-3034s1c1
Sequence:CCGGCCAGTGATACCATCGAGCTTTCTCGAGAAAGCTCGATGGTATCACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-470s1c1
Sequence:CCGGCAGTAACTGATGACCTCCAGACTCGAGTCTGGAGGTCATCAGTTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-342s1c1
Sequence:CCGGCAGTCACAGGAACTCTGATGTCTCGAGACATCAGAGTTCCTGTGACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-1344s1c1
Sequence:CCGGGCTCTGTCTAGTAACTGAGAACTCGAGTTCTCAGTTACTAGACAGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-582s1c1
Sequence:CCGGCCACCCTCATCTCACTTTCATCTCGAGATGAAAGTGAGATGAGGGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.2-2301s1c1
Sequence:CCGGGAGCGACCCAATAACTGCTATCTCGAGATAGCAGTTATTGGGTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-1265s1c1
Sequence:CCGGCAGCTGTAAACCGAACAGAGACTCGAGTCTCTGTTCGGTTTACAGCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000165834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-250s1c1
Sequence:CCGGGAAATCCCTATGATCCCTGGACTCGAGTCCAGGGATCATAGGGATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-1150s1c1
Sequence:CCGGCCAGAGAGAGCAGCAATGAATCTCGAGATTCATTGCTGCTCTCTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207351
PRRT3 MISSION shRNA Lentiviral Transduction Particles
proline-rich transmembrane protein 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166795    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_207351.2-3218s1c1
Sequence:CCGGCCGTGTCTTATGCGGAATACACTCGAGTGTATTCCGCATAAGACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-340s1c1
Sequence:CCGGGACAGTCACAGGAACTCTGATCTCGAGATCAGAGTTCCTGTGACTGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.2-3034s1c1
Sequence:CCGGCCAGTGATACCATCGAGCTTTCTCGAGAAAGCTCGATGGTATCACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-470s1c1
Sequence:CCGGCAGTAACTGATGACCTCCAGACTCGAGTCTGGAGGTCATCAGTTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-342s1c1
Sequence:CCGGCAGTCACAGGAACTCTGATGTCTCGAGACATCAGAGTTCCTGTGACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-1344s1c1
Sequence:CCGGGCTCTGTCTAGTAACTGAGAACTCGAGTTCTCAGTTACTAGACAGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-582s1c1
Sequence:CCGGCCACCCTCATCTCACTTTCATCTCGAGATGAAAGTGAGATGAGGGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.2-2301s1c1
Sequence:CCGGGAGCGACCCAATAACTGCTATCTCGAGATAGCAGTTATTGGGTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-1265s1c1
Sequence:CCGGCAGCTGTAAACCGAACAGAGACTCGAGTCTCTGTTCGGTTTACAGCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000165834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-250s1c1
Sequence:CCGGGAAATCCCTATGATCCCTGGACTCGAGTCCAGGGATCATAGGGATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207351.1-1150s1c1
Sequence:CCGGCCAGAGAGAGCAGCAATGAATCTCGAGATTCATTGCTGCTCTCTCTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)