EMAIL THIS PAGE TO A FRIEND

PRRT4

proline-rich transmembrane protein 4

64 Gene Product Result for
UniProtKB ID: C9JH25, A4D0Z9, C9JVW7
Gene ID:
Mouse(101359) proline-rich transmembrane protein 4
Rat(500059) proline-rich transmembrane protein 4
domestic cat(101084018) proline-rich transmembrane protein 4
dog(100687524) proline-rich transmembrane protein 4
naked mole-rat(101721170) proline-rich transmembrane protein 4
domestic guinea pig(100728165) proline-rich transmembrane protein 4
cow(100335204) proline-rich transmembrane protein 4
sheep(101103891) proline-rich transmembrane protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001101443 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101443 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101443 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001114726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001114726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001114726 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001114726 Rosetta Predictions human pricing
XM_379517 Rosetta Predictions human pricing
NM_001109226 Rosetta Predictions rat pricing
NM_001101443 Rosetta Predictions mouse pricing
XM_149840 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00326764 predicted 980
2 SASI_Hs02_00326765 predicted 3095
3 SASI_Hs02_00326766 predicted 2334
4 SASI_Hs02_00326767 predicted 337
5 SASI_Hs02_00326768 predicted 846
6 SASI_Hs02_00326769 predicted 216
7 SASI_Hs02_00326770 predicted 925
8 SASI_Hs02_00326771 predicted 675
9 SASI_Hs02_00326772 predicted 505
10 SASI_Hs02_00326773 predicted 3061
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_379517 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00289490 predicted 601
2 SASI_Hs01_00289491 predicted 1228
3 SASI_Hs01_00289492 predicted 2414
4 SASI_Hs01_00289493 predicted 585
5 SASI_Hs01_00289494 predicted 571
6 SASI_Hs01_00289495 predicted 474
7 SASI_Hs01_00289496 predicted 1172
8 SASI_Hs01_00289497 predicted 927
9 SASI_Hs01_00289498 predicted 761
10 SASI_Hs01_00289499 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109226 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246324 predicted 902
2 SASI_Rn02_00246325 predicted 1090
3 SASI_Rn02_00246326 predicted 881
4 SASI_Rn02_00246327 predicted 864
5 SASI_Rn02_00246328 predicted 717
6 SASI_Rn02_00246329 predicted 933
7 SASI_Rn02_00246330 predicted 1005
8 SASI_Rn02_00246331 predicted 2601
9 SASI_Rn02_00246332 predicted 2344
10 SASI_Rn02_00246333 predicted 456
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302359 predicted 2026
2 SASI_Mm02_00302360 predicted 1140
3 SASI_Mm02_00302361 predicted 714
4 SASI_Mm02_00302362 predicted 1004
5 SASI_Mm02_00302363 predicted 2515
6 SASI_Mm02_00302364 predicted 632
7 SASI_Mm02_00302365 predicted 718
8 SASI_Mm02_00302366 predicted 2405
9 SASI_Mm02_00302367 predicted 2513
10 SASI_Mm02_00302368 predicted 716
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_149840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224533 predicted 1085
2 SASI_Mm01_00224534 predicted 1092
3 SASI_Mm01_00224535 predicted 727
4 SASI_Mm01_00224536 predicted 1158
5 SASI_Mm01_00224537 predicted 1017
6 SASI_Mm01_00224538 predicted 2523
7 SASI_Mm01_00224539 predicted 637
8 SASI_Mm01_00224540 predicted 718
9 SASI_Mm01_00224541 predicted 2523
10 SASI_Mm01_00224542 predicted 848
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101443
VALIDATED
PRRT4 MISSION shRNA Bacterial Glycerol Stock
proline-rich transmembrane protein 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101443.1-937s21c1
Sequence:CCGGCAGATTCTCCTGGGCTCTTTGCTCGAGCAAAGAGCCCAGGAGAATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101443.1-2973s21c1
Sequence:CCGGGACCTCCTCACTGTAACAATTCTCGAGAATTGTTACAGTGAGGAGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001101443.1-2518s21c1
Sequence:CCGGCCAGTGAGAAGTCCGAGAATGCTCGAGCATTCTCGGACTTCTCACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001101443.1-724s21c1
Sequence:CCGGTGAAGTTTGATGTAGCTTTAACTCGAGTTAAAGCTACATCAAACTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001101443.1-2842s21c1
Sequence:CCGGTGGATGCTTGTCGACAGATTGCTCGAGCAATCTGTCGACAAGCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101443
VALIDATED
PRRT4 MISSION shRNA shRNA Plasmid DNA
proline-rich transmembrane protein 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101443.1-937s21c1
Sequence:CCGGCAGATTCTCCTGGGCTCTTTGCTCGAGCAAAGAGCCCAGGAGAATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101443.1-2973s21c1
Sequence:CCGGGACCTCCTCACTGTAACAATTCTCGAGAATTGTTACAGTGAGGAGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001101443.1-2518s21c1
Sequence:CCGGCCAGTGAGAAGTCCGAGAATGCTCGAGCATTCTCGGACTTCTCACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000283458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001101443.1-724s21c1
Sequence:CCGGTGAAGTTTGATGTAGCTTTAACTCGAGTTAAAGCTACATCAAACTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000346097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001101443.1-2842s21c1
Sequence:CCGGTGGATGCTTGTCGACAGATTGCTCGAGCAATCTGTCGACAAGCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101443
VALIDATED
PRRT4 MISSION shRNA Lentiviral Transduction Particles
proline-rich transmembrane protein 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101443.1-937s21c1
Sequence:CCGGCAGATTCTCCTGGGCTCTTTGCTCGAGCAAAGAGCCCAGGAGAATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345990    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001101443.1-2973s21c1
Sequence:CCGGGACCTCCTCACTGTAACAATTCTCGAGAATTGTTACAGTGAGGAGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001101443.1-2518s21c1
Sequence:CCGGCCAGTGAGAAGTCCGAGAATGCTCGAGCATTCTCGGACTTCTCACTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000283458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001101443.1-724s21c1
Sequence:CCGGTGAAGTTTGATGTAGCTTTAACTCGAGTTAAAGCTACATCAAACTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000346097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001101443.1-2842s21c1
Sequence:CCGGTGGATGCTTGTCGACAGATTGCTCGAGCAATCTGTCGACAAGCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001114726
PRRT4 MISSION shRNA Bacterial Glycerol Stock
proline-rich transmembrane protein 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000264242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-1053s21c1
Sequence:CCGGTCGATTGCAACAACATCATTACTCGAGTAATGATGTTGTTGCAATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114726.1-2907s21c1
Sequence:CCGGCACCTTGCTACCCTGCGATATCTCGAGATATCGCAGGGTAGCAAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-229s21c1
Sequence:CCGGTGTTCTGCTGCGTCCTGTTTGCTCGAGCAAACAGGACGCAGCAGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-349s21c1
Sequence:CCGGACCTGGGACTTAACTTCAAATCTCGAGATTTGAAGTTAAGTCCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-2324s21c1
Sequence:CCGGTTCCTCTCCCTGCAGCGATTACTCGAGTAATCGCTGCAGGGAGAGGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001114726
PRRT4 MISSION shRNA shRNA Plasmid DNA
proline-rich transmembrane protein 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000264242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-1053s21c1
Sequence:CCGGTCGATTGCAACAACATCATTACTCGAGTAATGATGTTGTTGCAATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114726.1-2907s21c1
Sequence:CCGGCACCTTGCTACCCTGCGATATCTCGAGATATCGCAGGGTAGCAAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-229s21c1
Sequence:CCGGTGTTCTGCTGCGTCCTGTTTGCTCGAGCAAACAGGACGCAGCAGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-349s21c1
Sequence:CCGGACCTGGGACTTAACTTCAAATCTCGAGATTTGAAGTTAAGTCCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000264241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-2324s21c1
Sequence:CCGGTTCCTCTCCCTGCAGCGATTACTCGAGTAATCGCTGCAGGGAGAGGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001114726
PRRT4 MISSION shRNA Lentiviral Transduction Particles
proline-rich transmembrane protein 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000264242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-1053s21c1
Sequence:CCGGTCGATTGCAACAACATCATTACTCGAGTAATGATGTTGTTGCAATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264239    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001114726.1-2907s21c1
Sequence:CCGGCACCTTGCTACCCTGCGATATCTCGAGATATCGCAGGGTAGCAAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-229s21c1
Sequence:CCGGTGTTCTGCTGCGTCCTGTTTGCTCGAGCAAACAGGACGCAGCAGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-349s21c1
Sequence:CCGGACCTGGGACTTAACTTCAAATCTCGAGATTTGAAGTTAAGTCCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000264241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001114726.1-2324s21c1
Sequence:CCGGTTCCTCTCCCTGCAGCGATTACTCGAGTAATCGCTGCAGGGAGAGGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)