EMAIL THIS PAGE TO A FRIEND

PRRX2

paired related homeobox 2

42 Gene Product Result for
Synonyms: PMX2 PRX2
UniProtKB ID: Q99811, Q5SZB5, Q9UIB3
Gene ID:
Human(51450) Summary: The DNA-associated protein encoded by this gene is a member of the paired family of homeobox proteins. Expression is localized to proliferating fetal fibroblasts and the developing dermal layer, with downregulated expression in adult skin. Increases in expression of this gene during fetal but not adult wound healing suggest a possible role in mechanisms that control mammalian dermal regeneration and prevent formation of scar response to wounding. The expression patterns provide evidence consistent with a role in fetal skin development and a possible role in cellular proliferation. [provided by RefSeq, Jul 2008]
Mouse(20204) paired related homeobox 2
Rat(113931) paired related homeobox 2
chicken(396314) paired related homeobox 2
dog(491298) paired related homeobox 2
domestic cat(101095528) paired related homeobox 2
naked mole-rat(101698981) paired related homeobox 2
domestic guinea pig(100733511) paired related homeobox 2
cow(534258) paired related homeobox 2
sheep(101104390) paired related homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016307 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016307 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016307 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009116 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009116 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009116 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016307 Rosetta Predictions human pricing
NM_001105739 Rosetta Predictions rat pricing
NM_009116 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016307 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157862 predicted 659
2 SASI_Hs01_00157863 predicted 968
3 SASI_Hs01_00157864 predicted 807
4 SASI_Hs01_00157865 predicted 801
5 SASI_Hs01_00157866 predicted 809
6 SASI_Hs02_00349235 predicted 924
7 SASI_Hs01_00157861 predicted 1056
8 SASI_Hs01_00157868 predicted 939
9 SASI_Hs01_00157869 predicted 1145
10 SASI_Hs01_00157870 predicted 1228
11 SASI_Hs01_00157867 predicted 635
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105739 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212056 predicted 708
2 SASI_Rn02_00212057 predicted 852
3 SASI_Rn02_00212058 predicted 837
4 SASI_Rn02_00212059 predicted 444
5 SASI_Rn02_00212060 predicted 492
6 SASI_Rn02_00212061 predicted 708
7 SASI_Rn02_00212062 predicted 795
8 SASI_Rn02_00212063 predicted 597
9 SASI_Rn02_00212064 predicted 938
10 SASI_Rn02_00212065 predicted 447
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009116 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124987 predicted 645
2 SASI_Mm01_00124989 predicted 782
3 SASI_Mm01_00124990 predicted 446
4 SASI_Mm01_00124991 predicted 602
5 SASI_Mm01_00124992 predicted 851
6 SASI_Mm01_00124993 predicted 447
7 SASI_Mm01_00124994 predicted 527
8 SASI_Mm01_00124995 predicted 565
9 SASI_Mm01_00124996 predicted 491
10 SASI_Mm02_00315387 predicted 977
11 SASI_Mm01_00124988 predicted 852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016307
VALIDATED
PRRX2 MISSION shRNA Bacterial Glycerol Stock
paired related homeobox 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-850s21c1
Sequence:CCGGACAGCACAGTGCCACCCTACACTCGAGTGTAGGGTGGCACTGTGCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-972s21c1
Sequence:CCGGGTGCCTACGGTGAACTGAAGTCTCGAGACTTCAGTTCACCGTAGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016307.3-1049s21c1
Sequence:CCGGAGACGCCCAGGAAGTGACCTTCTCGAGAAGGTCACTTCCTGGGCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-665s21c1
Sequence:CCGGGCGCGTTCAGGTCTGGTTTCACTCGAGTGAAACCAGACCTGAACGCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-944s21c1
Sequence:CCGGCAAGGAGTTCAGCCTGCACCACTCGAGTGGTGCAGGCTGAACTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-903s21c1
Sequence:CCGGGTCAACATGGCCAACAGCATCCTCGAGGATGCTGTTGGCCATGTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016307.3-932s1c1
Sequence:CCGGCCGTCTCAAGGCCAAGGAGTTCTCGAGAACTCCTTGGCCTTGAGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016307.3-808s1c1
Sequence:CCGGCCCTGAGTCCAGATTATCTCTCTCGAGAGAGATAATCTGGACTCAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016307.3-816s1c1
Sequence:CCGGCCAGATTATCTCTCCTGGACACTCGAGTGTCCAGGAGAGATAATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016307.3-552s1c1
Sequence:CCGGACCACGTTCAACAGCAGCCAACTCGAGTTGGCTGCTGTTGAACGTGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016307.3-1063s21c1
Sequence:CCGGTGACCTTCTCCTGGATGAGCTCTCGAGAGCTCATCCAGGAGAAGGTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000014778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016307.3-1021s1c1
Sequence:CCGGCTGGGTGGACAGCAATAGAAACTCGAGTTTCTATTGCTGTCCACCCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016307
VALIDATED
PRRX2 MISSION shRNA shRNA Plasmid DNA
paired related homeobox 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-850s21c1
Sequence:CCGGACAGCACAGTGCCACCCTACACTCGAGTGTAGGGTGGCACTGTGCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-972s21c1
Sequence:CCGGGTGCCTACGGTGAACTGAAGTCTCGAGACTTCAGTTCACCGTAGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016307.3-1049s21c1
Sequence:CCGGAGACGCCCAGGAAGTGACCTTCTCGAGAAGGTCACTTCCTGGGCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-665s21c1
Sequence:CCGGGCGCGTTCAGGTCTGGTTTCACTCGAGTGAAACCAGACCTGAACGCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-944s21c1
Sequence:CCGGCAAGGAGTTCAGCCTGCACCACTCGAGTGGTGCAGGCTGAACTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-903s21c1
Sequence:CCGGGTCAACATGGCCAACAGCATCCTCGAGGATGCTGTTGGCCATGTTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016307.3-932s1c1
Sequence:CCGGCCGTCTCAAGGCCAAGGAGTTCTCGAGAACTCCTTGGCCTTGAGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016307.3-808s1c1
Sequence:CCGGCCCTGAGTCCAGATTATCTCTCTCGAGAGAGATAATCTGGACTCAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016307.3-816s1c1
Sequence:CCGGCCAGATTATCTCTCCTGGACACTCGAGTGTCCAGGAGAGATAATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016307.3-552s1c1
Sequence:CCGGACCACGTTCAACAGCAGCCAACTCGAGTTGGCTGCTGTTGAACGTGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016307.3-1063s21c1
Sequence:CCGGTGACCTTCTCCTGGATGAGCTCTCGAGAGCTCATCCAGGAGAAGGTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000014778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016307.3-1021s1c1
Sequence:CCGGCTGGGTGGACAGCAATAGAAACTCGAGTTTCTATTGCTGTCCACCCAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016307
VALIDATED
PRRX2 MISSION shRNA Lentiviral Transduction Particles
paired related homeobox 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433406    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-850s21c1
Sequence:CCGGACAGCACAGTGCCACCCTACACTCGAGTGTAGGGTGGCACTGTGCTGTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-972s21c1
Sequence:CCGGGTGCCTACGGTGAACTGAAGTCTCGAGACTTCAGTTCACCGTAGGCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000414501    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016307.3-1049s21c1
Sequence:CCGGAGACGCCCAGGAAGTGACCTTCTCGAGAAGGTCACTTCCTGGGCGTCTTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000429268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-665s21c1
Sequence:CCGGGCGCGTTCAGGTCTGGTTTCACTCGAGTGAAACCAGACCTGAACGCGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000424555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-944s21c1
Sequence:CCGGCAAGGAGTTCAGCCTGCACCACTCGAGTGGTGCAGGCTGAACTCCTTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000420410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016307.3-903s21c1
Sequence:CCGGGTCAACATGGCCAACAGCATCCTCGAGGATGCTGTTGGCCATGTTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000014781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016307.3-932s1c1
Sequence:CCGGCCGTCTCAAGGCCAAGGAGTTCTCGAGAACTCCTTGGCCTTGAGACGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000014782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016307.3-808s1c1
Sequence:CCGGCCCTGAGTCCAGATTATCTCTCTCGAGAGAGATAATCTGGACTCAGGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000014779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016307.3-816s1c1
Sequence:CCGGCCAGATTATCTCTCCTGGACACTCGAGTGTCCAGGAGAGATAATCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000014780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016307.3-552s1c1
Sequence:CCGGACCACGTTCAACAGCAGCCAACTCGAGTTGGCTGCTGTTGAACGTGGTTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000418337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016307.3-1063s21c1
Sequence:CCGGTGACCTTCTCCTGGATGAGCTCTCGAGAGCTCATCCAGGAGAAGGTCATTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000014778    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_016307.3-1021s1c1
Sequence:CCGGCTGGGTGGACAGCAATAGAAACTCGAGTTTCTATTGCTGTCCACCCAGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009116
VALIDATED
PRRX2 MISSION shRNA Bacterial Glycerol Stock
paired related homeobox 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009116.2-926s21c1
Sequence:CCGGCCATCACAGCTTCCTGAGTTCCTCGAGGAACTCAGGAAGCTGTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009116.2-697s21c1
Sequence:CCGGCCGGAGGTTCAAGTCCTGCAACTCGAGTTGCAGGACTTGAACCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009116.2-365s21c1
Sequence:CCGGCCGGAATCGAACCACATTCAACTCGAGTTGAATGTGGTTCGATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009116.2-973s21c1
Sequence:CCGGGTTGAACAAGTCACTGCTATGCTCGAGCATAGCAGTGACTTGTTCAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000348080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009116.2-428s21c1
Sequence:CCGGACACTACCCTGACGCCTTTGTCTCGAGACAAAGGCGTCAGGGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009116.1-452s1c1
Sequence:CCGGCCGGAATCGAACCACATTCAACTCGAGTTGAATGTGGTTCGATTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009116.1-651s1c1
Sequence:CCGGGCCTCGTTGCTCAAGTCTTATCTCGAGATAAGACTTGAGCAACGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009116.1-784s1c1
Sequence:CCGGCCGGAGGTTCAAGTCCTGCAACTCGAGTTGCAGGACTTGAACCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009116.1-422s1c1
Sequence:CCGGCCGTGGCACCAAACGAAAGAACTCGAGTTCTTTCGTTTGGTGCCACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009116.1-603s1c1
Sequence:CCGGCGTGCCAAGTTTCGCCGGAATCTCGAGATTCCGGCGAAACTTGGCACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009116
VALIDATED
PRRX2 MISSION shRNA shRNA Plasmid DNA
paired related homeobox 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009116.2-926s21c1
Sequence:CCGGCCATCACAGCTTCCTGAGTTCCTCGAGGAACTCAGGAAGCTGTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009116.2-697s21c1
Sequence:CCGGCCGGAGGTTCAAGTCCTGCAACTCGAGTTGCAGGACTTGAACCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009116.2-365s21c1
Sequence:CCGGCCGGAATCGAACCACATTCAACTCGAGTTGAATGTGGTTCGATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009116.2-973s21c1
Sequence:CCGGGTTGAACAAGTCACTGCTATGCTCGAGCATAGCAGTGACTTGTTCAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000348080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009116.2-428s21c1
Sequence:CCGGACACTACCCTGACGCCTTTGTCTCGAGACAAAGGCGTCAGGGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009116.1-452s1c1
Sequence:CCGGCCGGAATCGAACCACATTCAACTCGAGTTGAATGTGGTTCGATTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009116.1-651s1c1
Sequence:CCGGGCCTCGTTGCTCAAGTCTTATCTCGAGATAAGACTTGAGCAACGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009116.1-784s1c1
Sequence:CCGGCCGGAGGTTCAAGTCCTGCAACTCGAGTTGCAGGACTTGAACCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009116.1-422s1c1
Sequence:CCGGCCGTGGCACCAAACGAAAGAACTCGAGTTCTTTCGTTTGGTGCCACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009116.1-603s1c1
Sequence:CCGGCGTGCCAAGTTTCGCCGGAATCTCGAGATTCCGGCGAAACTTGGCACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009116
VALIDATED
PRRX2 MISSION shRNA Lentiviral Transduction Particles
paired related homeobox 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374220    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009116.2-926s21c1
Sequence:CCGGCCATCACAGCTTCCTGAGTTCCTCGAGGAACTCAGGAAGCTGTGATGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000333923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009116.2-697s21c1
Sequence:CCGGCCGGAGGTTCAAGTCCTGCAACTCGAGTTGCAGGACTTGAACCTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000333922    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009116.2-365s21c1
Sequence:CCGGCCGGAATCGAACCACATTCAACTCGAGTTGAATGTGGTTCGATTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000348003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009116.2-973s21c1
Sequence:CCGGGTTGAACAAGTCACTGCTATGCTCGAGCATAGCAGTGACTTGTTCAACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000348080    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009116.2-428s21c1
Sequence:CCGGACACTACCCTGACGCCTTTGTCTCGAGACAAAGGCGTCAGGGTAGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009116.1-452s1c1
Sequence:CCGGCCGGAATCGAACCACATTCAACTCGAGTTGAATGTGGTTCGATTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009116.1-651s1c1
Sequence:CCGGGCCTCGTTGCTCAAGTCTTATCTCGAGATAAGACTTGAGCAACGAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009116.1-784s1c1
Sequence:CCGGCCGGAGGTTCAAGTCCTGCAACTCGAGTTGCAGGACTTGAACCTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070752    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009116.1-422s1c1
Sequence:CCGGCCGTGGCACCAAACGAAAGAACTCGAGTTCTTTCGTTTGGTGCCACGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000070750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009116.1-603s1c1
Sequence:CCGGCGTGCCAAGTTTCGCCGGAATCTCGAGATTCCGGCGAAACTTGGCACGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???