EMAIL THIS PAGE TO A FRIEND

PRSS16

protease, serine, 16 (thymus)

107 Gene Product Result for
Synonyms: TSSP
UniProtKB ID: Q9NQE7, O75416
Gene ID:
Human(10279) Summary: This gene encodes a serine protease expressed exclusively in the thymus. It is thought to play a role in the alternative antigen presenting pathway used by cortical thymic epithelial cells during the positive selection of T cells. The gene is found in the large histone gene cluster on chromosome 6, near the major histocompatibility complex (MHC) class I region. A second transcript variant has been described, but its full length nature has not been determined. [provided by RefSeq, Jul 2008]
Mouse(54373) protease, serine, 16 (thymus)
Rat(364719) protease, serine, 16 (thymus)
domestic cat(101082149) protease, serine, 16 (thymus)
dog(488292) protease, serine, 16 (thymus)
cow(614489) protease, serine, 16 (thymus)
sheep(101105537) protease, serine, 16 (thymus)
Domestic Rabbit(100352361) protease, serine, 16 (thymus)
naked mole-rat(101724297) protease, serine, 16 (thymus)
domestic guinea pig(100718732) protease, serine, 16 (thymus)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019429 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019429 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019429 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005865 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005865 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005865 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005865 Rosetta Predictions human pricing
NM_001033710 Rosetta Predictions rat pricing
NM_019429 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005865 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00192678 predicted 384
2 SASI_Hs01_00192679 predicted 1596
3 SASI_Hs02_00340430 predicted 651
4 SASI_Hs01_00192680 predicted 248
5 SASI_Hs01_00192681 predicted 1538
6 SASI_Hs01_00192682 predicted 1314
7 SASI_Hs01_00192683 predicted 1138
8 SASI_Hs01_00192685 predicted 500
9 SASI_Hs01_00192686 predicted 661
10 SASI_Hs01_00192687 predicted 227
11 SASI_Hs01_00192684 predicted 1397
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033710 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066648 predicted 1149
2 SASI_Rn01_00066649 predicted 410
3 SASI_Rn01_00066650 predicted 288
4 SASI_Rn02_00203749 predicted 397
5 SASI_Rn01_00066652 predicted 1450
6 SASI_Rn01_00066653 predicted 1378
7 SASI_Rn01_00066654 predicted 1510
8 SASI_Rn01_00066655 predicted 645
9 SASI_Rn01_00066656 predicted 525
10 SASI_Rn01_00066657 predicted 1095
11 SASI_Rn01_00066651 predicted 1234
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019429 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324364 predicted 1427
2 SASI_Mm01_00168002 predicted 1063
3 SASI_Mm01_00168003 predicted 301
4 SASI_Mm01_00168005 predicted 1468
5 SASI_Mm01_00168006 predicted 263
6 SASI_Mm01_00168007 predicted 428
7 SASI_Mm01_00168008 predicted 545
8 SASI_Mm01_00168009 predicted 208
9 SASI_Mm01_00168010 predicted 727
10 SASI_Mm02_00324365 predicted 1255
11 SASI_Mm01_00168001 predicted 1179
12 SASI_Mm01_00168004 predicted 1349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019429
PRSS16 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 16 (thymus)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019429.1-1863s1c1
Sequence:CCGGCCCAGATAAGAACCTGGCTTACTCGAGTAAGCCAGGTTCTTATCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-1432s1c1
Sequence:CCGGCCCTTCTAATTCCTAGTGCTTCTCGAGAAGCACTAGGAATTAGAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-1308s1c1
Sequence:CCGGGCCCAGACAAACTCCTATTATCTCGAGATAATAGGAGTTTGTCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-547s1c1
Sequence:CCGGGCCTCCTCAATGTGTCTTCTTCTCGAGAAGAAGACACATTGAGGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-210s1c1
Sequence:CCGGCCCAAACAAGGGTGGTTAGAACTCGAGTTCTAACCACCCTTGTTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019429.2-1748s21c1
Sequence:CCGGTCTTTGTCACGGATTAGTATACTCGAGTATACTAATCCGTGACAAAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019429.2-1539s21c1
Sequence:CCGGGATTGGCTCAAAGATATAAAGCTCGAGCTTTATATCTTTGAGCCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019429.2-687s21c1
Sequence:CCGGGTGGACTTCTCCGCCTATAACCTCGAGGTTATAGGCGGAGAAGTCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019429.2-735s21c1
Sequence:CCGGGTCGCCATAGGAGGATCATTGCTCGAGCAATGATCCTCCTATGGCGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019429
PRSS16 MISSION shRNA shRNA Plasmid DNA
protease, serine, 16 (thymus)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019429.1-1863s1c1
Sequence:CCGGCCCAGATAAGAACCTGGCTTACTCGAGTAAGCCAGGTTCTTATCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-1432s1c1
Sequence:CCGGCCCTTCTAATTCCTAGTGCTTCTCGAGAAGCACTAGGAATTAGAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-1308s1c1
Sequence:CCGGGCCCAGACAAACTCCTATTATCTCGAGATAATAGGAGTTTGTCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-547s1c1
Sequence:CCGGGCCTCCTCAATGTGTCTTCTTCTCGAGAAGAAGACACATTGAGGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-210s1c1
Sequence:CCGGCCCAAACAAGGGTGGTTAGAACTCGAGTTCTAACCACCCTTGTTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019429.2-1748s21c1
Sequence:CCGGTCTTTGTCACGGATTAGTATACTCGAGTATACTAATCCGTGACAAAGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019429.2-1539s21c1
Sequence:CCGGGATTGGCTCAAAGATATAAAGCTCGAGCTTTATATCTTTGAGCCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019429.2-687s21c1
Sequence:CCGGGTGGACTTCTCCGCCTATAACCTCGAGGTTATAGGCGGAGAAGTCCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000416419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019429.2-735s21c1
Sequence:CCGGGTCGCCATAGGAGGATCATTGCTCGAGCAATGATCCTCCTATGGCGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019429
PRSS16 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 16 (thymus)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032524    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019429.1-1863s1c1
Sequence:CCGGCCCAGATAAGAACCTGGCTTACTCGAGTAAGCCAGGTTCTTATCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-1432s1c1
Sequence:CCGGCCCTTCTAATTCCTAGTGCTTCTCGAGAAGCACTAGGAATTAGAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-1308s1c1
Sequence:CCGGGCCCAGACAAACTCCTATTATCTCGAGATAATAGGAGTTTGTCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-547s1c1
Sequence:CCGGGCCTCCTCAATGTGTCTTCTTCTCGAGAAGAAGACACATTGAGGAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019429.1-210s1c1
Sequence:CCGGCCCAAACAAGGGTGGTTAGAACTCGAGTTCTAACCACCCTTGTTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413226    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019429.2-1748s21c1
Sequence:CCGGTCTTTGTCACGGATTAGTATACTCGAGTATACTAATCCGTGACAAAGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019429.2-1539s21c1
Sequence:CCGGGATTGGCTCAAAGATATAAAGCTCGAGCTTTATATCTTTGAGCCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425691    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019429.2-687s21c1
Sequence:CCGGGTGGACTTCTCCGCCTATAACCTCGAGGTTATAGGCGGAGAAGTCCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000416419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019429.2-735s21c1
Sequence:CCGGGTCGCCATAGGAGGATCATTGCTCGAGCAATGATCCTCCTATGGCGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005865
PRSS16 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 16 (thymus)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005865.3-1229s21c1
Sequence:CCGGACCTATGTGAGCAGGTGTTTGCTCGAGCAAACACCTGCTCACATAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-668s1c1
Sequence:CCGGCCGAGTATAATGACGTGGTATCTCGAGATACCACGTCATTATACTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-657s1c1
Sequence:CCGGGCTGGATTTCTCCGAGTATAACTCGAGTTATACTCGGAGAAATCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-244s1c1
Sequence:CCGGCTACAGCGTTACTGGGTGAATCTCGAGATTCACCCAGTAACGCTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-1318s1c1
Sequence:CCGGGCTAACAAAGTGCTGTTTGTTCTCGAGAACAAACAGCACTTTGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-1365s1c1
Sequence:CCGGGCTAAGTGTAACACAGGCTTTCTCGAGAAAGCCTGTGTTACACTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005865.3-1675s21c1
Sequence:CCGGGCACCTGTTCCGCACGTAATTCTCGAGAATTACGTGCGGAACAGGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005865.3-1712s21c1
Sequence:CCGGCATCCTTATTCCCAACTTAAACTCGAGTTTAAGTTGGGAATAAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005865
PRSS16 MISSION shRNA shRNA Plasmid DNA
protease, serine, 16 (thymus)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005865.3-1229s21c1
Sequence:CCGGACCTATGTGAGCAGGTGTTTGCTCGAGCAAACACCTGCTCACATAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-668s1c1
Sequence:CCGGCCGAGTATAATGACGTGGTATCTCGAGATACCACGTCATTATACTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-657s1c1
Sequence:CCGGGCTGGATTTCTCCGAGTATAACTCGAGTTATACTCGGAGAAATCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-244s1c1
Sequence:CCGGCTACAGCGTTACTGGGTGAATCTCGAGATTCACCCAGTAACGCTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-1318s1c1
Sequence:CCGGGCTAACAAAGTGCTGTTTGTTCTCGAGAACAAACAGCACTTTGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-1365s1c1
Sequence:CCGGGCTAAGTGTAACACAGGCTTTCTCGAGAAAGCCTGTGTTACACTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000441410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005865.3-1675s21c1
Sequence:CCGGGCACCTGTTCCGCACGTAATTCTCGAGAATTACGTGCGGAACAGGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005865.3-1712s21c1
Sequence:CCGGCATCCTTATTCCCAACTTAAACTCGAGTTTAAGTTGGGAATAAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005865
PRSS16 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 16 (thymus)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005865.3-1229s21c1
Sequence:CCGGACCTATGTGAGCAGGTGTTTGCTCGAGCAAACACCTGCTCACATAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-668s1c1
Sequence:CCGGCCGAGTATAATGACGTGGTATCTCGAGATACCACGTCATTATACTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-657s1c1
Sequence:CCGGGCTGGATTTCTCCGAGTATAACTCGAGTTATACTCGGAGAAATCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-244s1c1
Sequence:CCGGCTACAGCGTTACTGGGTGAATCTCGAGATTCACCCAGTAACGCTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-1318s1c1
Sequence:CCGGGCTAACAAAGTGCTGTTTGTTCTCGAGAACAAACAGCACTTTGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005865.2-1365s1c1
Sequence:CCGGGCTAAGTGTAACACAGGCTTTCTCGAGAAAGCCTGTGTTACACTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000441410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005865.3-1675s21c1
Sequence:CCGGGCACCTGTTCCGCACGTAATTCTCGAGAATTACGTGCGGAACAGGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427461    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005865.3-1712s21c1
Sequence:CCGGCATCCTTATTCCCAACTTAAACTCGAGTTTAAGTTGGGAATAAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)