EMAIL THIS PAGE TO A FRIEND

PRSS1

protease, serine, 1 (trypsin 1)

49 Gene Product Result for
Synonyms: TRP1 TRY1 TRY4 TRYP1
Gene ID:
Human(5644) Summary: This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Mutations in this gene are associated with hereditary pancreatitis. This gene and several other trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. [provided by RefSeq, Jul 2008]
Mouse(114228) protease, serine, 1 (trypsin 1)
Rat(24691) protease, serine, 1 (trypsin 1)
dog(475521) protease, serine, 1 (trypsin 1)
cow(615026) protease, serine, 1 (trypsin 1)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_053243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_053243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_053243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002769 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002769 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002769 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU219031 MISSION® esiRNA esiRNA targeting human PRSS1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002769 Rosetta Predictions human pricing
NM_012635 Rosetta Predictions rat pricing
NM_053243 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002769 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236608 predicted 579
2 SASI_Hs02_00334395 predicted 594
3 SASI_Hs01_00236601 predicted 351
4 SASI_Hs01_00236602 predicted 349
5 SASI_Hs01_00236603 predicted 306
6 SASI_Hs01_00236604 predicted 349
7 SASI_Hs01_00236605 predicted 321
8 SASI_Hs01_00236606 predicted 324
9 SASI_Hs01_00236607 predicted 451
10 SASI_Hs01_00236609 predicted 418
11 SASI_Hs01_00236610 predicted 532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012635 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109634 predicted 541
2 SASI_Rn01_00109635 predicted 451
3 SASI_Rn01_00109636 predicted 255
4 SASI_Rn01_00109639 predicted 301
5 SASI_Rn01_00109640 predicted 252
6 SASI_Rn01_00109642 predicted 467
7 SASI_Rn02_00259861 predicted 737
8 SASI_Rn02_00259862 predicted 757
9 SASI_Rn02_00259863 predicted 749
10 SASI_Rn02_00259864 predicted 708
11 SASI_Rn01_00109637 predicted 247
12 SASI_Rn01_00109638 predicted 200
13 SASI_Rn01_00109641 predicted 206
14 SASI_Rn01_00109643 predicted 554
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053243 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087319 predicted 312
2 SASI_Mm01_00087317 predicted 260
3 SASI_Mm01_00087318 predicted 505
4 SASI_Mm01_00087320 predicted 243
5 SASI_Mm01_00087321 predicted 261
6 SASI_Mm01_00087322 predicted 309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_053243
PRSS1 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 1 (trypsin 1)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-309s1c1
Sequence:CCGGCCTGAACAATGACATCATGTTCTCGAGAACATGATGTCATTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-90s1c1
Sequence:CCGGCCGAGAGAATTCTGTTCCCTACTCGAGTAGGGAACAGAATTCTCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-525s1c1
Sequence:CCGGTCCTGGGAAGATCACTGGTAACTCGAGTTACCAGTGATCTTCCCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-225s1c1
Sequence:CCGGGCACAATATCAATGTCCTGGACTCGAGTCCAGGACATTGATATTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-441s1c1
Sequence:CCGGTCTTAGCTTTGGTGTCAGTGACTCGAGTCACTGACACCAAAGCTAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_053243
PRSS1 MISSION shRNA shRNA Plasmid DNA
protease, serine, 1 (trypsin 1)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-309s1c1
Sequence:CCGGCCTGAACAATGACATCATGTTCTCGAGAACATGATGTCATTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-90s1c1
Sequence:CCGGCCGAGAGAATTCTGTTCCCTACTCGAGTAGGGAACAGAATTCTCTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-525s1c1
Sequence:CCGGTCCTGGGAAGATCACTGGTAACTCGAGTTACCAGTGATCTTCCCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-225s1c1
Sequence:CCGGGCACAATATCAATGTCCTGGACTCGAGTCCAGGACATTGATATTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000031970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-441s1c1
Sequence:CCGGTCTTAGCTTTGGTGTCAGTGACTCGAGTCACTGACACCAAAGCTAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_053243
PRSS1 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 1 (trypsin 1)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031969    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-309s1c1
Sequence:CCGGCCTGAACAATGACATCATGTTCTCGAGAACATGATGTCATTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-90s1c1
Sequence:CCGGCCGAGAGAATTCTGTTCCCTACTCGAGTAGGGAACAGAATTCTCTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031972    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-525s1c1
Sequence:CCGGTCCTGGGAAGATCACTGGTAACTCGAGTTACCAGTGATCTTCCCAGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-225s1c1
Sequence:CCGGGCACAATATCAATGTCCTGGACTCGAGTCCAGGACATTGATATTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000031970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_053243.1-441s1c1
Sequence:CCGGTCTTAGCTTTGGTGTCAGTGACTCGAGTCACTGACACCAAAGCTAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002769
PRSS1 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 1 (trypsin 1)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-303s1c1
Sequence:CCGGCGACAGGAAGACTCTGAACAACTCGAGTTGTTCAGAGTCTTCCTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-408s1c1
Sequence:CCGGCACTGGCACGAAGTGCCTCATCTCGAGATGAGGCACTTCGTGCCAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-316s1c1
Sequence:CCGGCTGAACAATGACATCATGTTACTCGAGTAACATGATGTCATTGTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-531s1c1
Sequence:CCGGCCCTGGAAAGATTACCAGCAACTCGAGTTGCTGGTAATCTTTCCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-86s1c1
Sequence:CCGGGCTACAACTGTGAGGAGAATTCTCGAGAATTCTCCTCACAGTTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002769.3-265s21c1
Sequence:CCGGGGAATGAGCAGTTCATCAATGCTCGAGCATTGATGAACTGCTCATTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002769.3-596s21c1
Sequence:CCGGGGATTCATGTCAGGGTGATTCCTCGAGGAATCACCCTGACATGAATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002769.3-353s21c1
Sequence:CCGGGCTCTCCTCACGTGCAGTAATCTCGAGATTACTGCACGTGAGGAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002769
PRSS1 MISSION shRNA shRNA Plasmid DNA
protease, serine, 1 (trypsin 1)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-303s1c1
Sequence:CCGGCGACAGGAAGACTCTGAACAACTCGAGTTGTTCAGAGTCTTCCTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-408s1c1
Sequence:CCGGCACTGGCACGAAGTGCCTCATCTCGAGATGAGGCACTTCGTGCCAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-316s1c1
Sequence:CCGGCTGAACAATGACATCATGTTACTCGAGTAACATGATGTCATTGTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-531s1c1
Sequence:CCGGCCCTGGAAAGATTACCAGCAACTCGAGTTGCTGGTAATCTTTCCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-86s1c1
Sequence:CCGGGCTACAACTGTGAGGAGAATTCTCGAGAATTCTCCTCACAGTTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002769.3-265s21c1
Sequence:CCGGGGAATGAGCAGTTCATCAATGCTCGAGCATTGATGAACTGCTCATTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002769.3-596s21c1
Sequence:CCGGGGATTCATGTCAGGGTGATTCCTCGAGGAATCACCCTGACATGAATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002769.3-353s21c1
Sequence:CCGGGCTCTCCTCACGTGCAGTAATCTCGAGATTACTGCACGTGAGGAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002769
PRSS1 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 1 (trypsin 1)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-303s1c1
Sequence:CCGGCGACAGGAAGACTCTGAACAACTCGAGTTGTTCAGAGTCTTCCTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-408s1c1
Sequence:CCGGCACTGGCACGAAGTGCCTCATCTCGAGATGAGGCACTTCGTGCCAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-316s1c1
Sequence:CCGGCTGAACAATGACATCATGTTACTCGAGTAACATGATGTCATTGTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-531s1c1
Sequence:CCGGCCCTGGAAAGATTACCAGCAACTCGAGTTGCTGGTAATCTTTCCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002769.2-86s1c1
Sequence:CCGGGCTACAACTGTGAGGAGAATTCTCGAGAATTCTCCTCACAGTTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373255    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002769.3-265s21c1
Sequence:CCGGGGAATGAGCAGTTCATCAATGCTCGAGCATTGATGAACTGCTCATTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002769.3-596s21c1
Sequence:CCGGGGATTCATGTCAGGGTGATTCCTCGAGGAATCACCCTGACATGAATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373301    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002769.3-353s21c1
Sequence:CCGGGCTCTCCTCACGTGCAGTAATCTCGAGATTACTGCACGTGAGGAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)