EMAIL THIS PAGE TO A FRIEND

PRSS22

protease, serine, 22

54 Gene Product Result for
Synonyms: BSSP-4 hBSSP-4
UniProtKB ID: Q9GZN4, O43342, Q6UXE0
Gene ID:
Human(64063) Summary: This gene encodes a member of the trypsin family of serine proteases. The enzyme is expressed in the airways in a developmentally regulated manner. The gene is part of a cluster of serine protease genes on chromosome 16. [provided by RefSeq, Jul 2008]
Mouse(70835) protease, serine, 22
Rat(302971) protease, serine, 22
naked mole-rat(101711135) protease, serine, 22
cow(510394) protease, serine, 22
sheep(101117723) protease, serine, 22
domestic cat(101100937) protease, serine, 22
dog(490056) protease, serine, 22
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0856 Mouse Prss22 / Brain-specific Serine Protease 4 ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022119 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022119 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022119 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133731 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133731 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133731 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022119 Rosetta Predictions human pricing
NM_001106984 Rosetta Predictions rat pricing
NM_133731 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115118 predicted 242
2 SASI_Hs01_00115119 predicted 464
3 SASI_Hs01_00115120 predicted 342
4 SASI_Hs01_00115121 predicted 652
5 SASI_Hs02_00355514 predicted 676
6 SASI_Hs01_00115122 predicted 502
7 SASI_Hs01_00115123 predicted 248
8 SASI_Hs01_00115124 predicted 329
9 SASI_Hs01_00115125 predicted 355
10 SASI_Hs01_00115126 predicted 715
11 SASI_Hs01_00115127 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106984 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224336 predicted 342
2 SASI_Rn02_00224337 predicted 646
3 SASI_Rn02_00224338 predicted 346
4 SASI_Rn02_00224339 predicted 257
5 SASI_Rn02_00224340 predicted 841
6 SASI_Rn02_00224341 predicted 832
7 SASI_Rn02_00224342 predicted 821
8 SASI_Rn02_00224343 predicted 553
9 SASI_Rn02_00224344 predicted 367
10 SASI_Rn02_00224345 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133731 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201121 predicted 845
2 SASI_Mm02_00338711 predicted 208
3 SASI_Mm01_00201122 predicted 217
4 SASI_Mm01_00201123 predicted 363
5 SASI_Mm01_00201124 predicted 280
6 SASI_Mm01_00201125 predicted 457
7 SASI_Mm02_00338712 predicted 495
8 SASI_Mm01_00201126 predicted 837
9 SASI_Mm01_00201127 predicted 526
10 SASI_Mm01_00201128 predicted 573
11 SASI_Mm01_00201120 predicted 377
12 SASI_Mm01_00201129 predicted 372
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022119
PRSS22 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 22
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022119.3-1063s21c1
Sequence:CCGGTCCACATCTGGATCTGGATCTCTCGAGAGATCCAGATCCAGATGTGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-227s1c1
Sequence:CCGGGATCGTGAGCATCCAGAAGAACTCGAGTTCTTCTGGATGCTCACGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-636s1c1
Sequence:CCGGGTTCCTATCATCGACTCGGAACTCGAGTTCCGAGTCGATGATAGGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-482s1c1
Sequence:CCGGGCGCTCCATACAGTTCTCAGACTCGAGTCTGAGAACTGTATGGAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-878s1c1
Sequence:CCGGGCACCGCTCCTGGGTGGAGAACTCGAGTTCTCCACCCAGGAGCGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-323s1c1
Sequence:CCGGCCTGAACAAACCATACCTGTTCTCGAGAACAGGTATGGTTTGTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022119.3-612s21c1
Sequence:CCGGCATCCAAGATGGAGTTCCCTTCTCGAGAAGGGAACTCCATCTTGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022119
PRSS22 MISSION shRNA shRNA Plasmid DNA
protease, serine, 22
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022119.3-1063s21c1
Sequence:CCGGTCCACATCTGGATCTGGATCTCTCGAGAGATCCAGATCCAGATGTGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-227s1c1
Sequence:CCGGGATCGTGAGCATCCAGAAGAACTCGAGTTCTTCTGGATGCTCACGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-636s1c1
Sequence:CCGGGTTCCTATCATCGACTCGGAACTCGAGTTCCGAGTCGATGATAGGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-482s1c1
Sequence:CCGGGCGCTCCATACAGTTCTCAGACTCGAGTCTGAGAACTGTATGGAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-878s1c1
Sequence:CCGGGCACCGCTCCTGGGTGGAGAACTCGAGTTCTCCACCCAGGAGCGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000046639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-323s1c1
Sequence:CCGGCCTGAACAAACCATACCTGTTCTCGAGAACAGGTATGGTTTGTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022119.3-612s21c1
Sequence:CCGGCATCCAAGATGGAGTTCCCTTCTCGAGAAGGGAACTCCATCTTGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022119
PRSS22 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 22
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022119.3-1063s21c1
Sequence:CCGGTCCACATCTGGATCTGGATCTCTCGAGAGATCCAGATCCAGATGTGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-227s1c1
Sequence:CCGGGATCGTGAGCATCCAGAAGAACTCGAGTTCTTCTGGATGCTCACGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-636s1c1
Sequence:CCGGGTTCCTATCATCGACTCGGAACTCGAGTTCCGAGTCGATGATAGGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-482s1c1
Sequence:CCGGGCGCTCCATACAGTTCTCAGACTCGAGTCTGAGAACTGTATGGAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-878s1c1
Sequence:CCGGGCACCGCTCCTGGGTGGAGAACTCGAGTTCTCCACCCAGGAGCGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000046639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022119.2-323s1c1
Sequence:CCGGCCTGAACAAACCATACCTGTTCTCGAGAACAGGTATGGTTTGTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022119.3-612s21c1
Sequence:CCGGCATCCAAGATGGAGTTCCCTTCTCGAGAAGGGAACTCCATCTTGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133731
VALIDATED
PRSS22 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 22
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000306614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133731.2-1035s21c1
Sequence:CCGGATGAGCAGCCTCCTGCAATTCCTCGAGGAATTGCAGGAGGCTGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-534s21c1
Sequence:CCGGCCTGGAACACTCCATCCAGTTCTCGAGAACTGGATGGAGTGTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-855s21c1
Sequence:CCGGCTGGCTACTGACTGGCATAATCTCGAGATTATGCCAGTCAGTAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-946s21c1
Sequence:CCGGTGGGTGCAAAGGATCGTTCAACTCGAGTTGAACGATCCTTTGCACCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133731.1-344s1c1
Sequence:CCGGGCGCACTGCTTTAAGAGCAATCTCGAGATTGCTCTTAAAGCAGTGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133731.1-517s1c1
Sequence:CCGGCCTGGAACACTCCATCCAGTTCTCGAGAACTGGATGGAGTGTTCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133731.1-265s1c1
Sequence:CCGGCTGGATTGTTAGCATCCTCAACTCGAGTTGAGGATGCTAACAATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133731.1-838s1c1
Sequence:CCGGCTGGCTACTGACTGGCATAATCTCGAGATTATGCCAGTCAGTAGCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-131s21c1
Sequence:CCGGGGGACCAGTTCAGCATCTTAACTCGAGTTAAGATGCTGAACTGGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133731
VALIDATED
PRSS22 MISSION shRNA shRNA Plasmid DNA
protease, serine, 22
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000306614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133731.2-1035s21c1
Sequence:CCGGATGAGCAGCCTCCTGCAATTCCTCGAGGAATTGCAGGAGGCTGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-534s21c1
Sequence:CCGGCCTGGAACACTCCATCCAGTTCTCGAGAACTGGATGGAGTGTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-855s21c1
Sequence:CCGGCTGGCTACTGACTGGCATAATCTCGAGATTATGCCAGTCAGTAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-946s21c1
Sequence:CCGGTGGGTGCAAAGGATCGTTCAACTCGAGTTGAACGATCCTTTGCACCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133731.1-344s1c1
Sequence:CCGGGCGCACTGCTTTAAGAGCAATCTCGAGATTGCTCTTAAAGCAGTGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133731.1-517s1c1
Sequence:CCGGCCTGGAACACTCCATCCAGTTCTCGAGAACTGGATGGAGTGTTCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133731.1-265s1c1
Sequence:CCGGCTGGATTGTTAGCATCCTCAACTCGAGTTGAGGATGCTAACAATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133731.1-838s1c1
Sequence:CCGGCTGGCTACTGACTGGCATAATCTCGAGATTATGCCAGTCAGTAGCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-131s21c1
Sequence:CCGGGGGACCAGTTCAGCATCTTAACTCGAGTTAAGATGCTGAACTGGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133731
VALIDATED
PRSS22 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 22
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000306614    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133731.2-1035s21c1
Sequence:CCGGATGAGCAGCCTCCTGCAATTCCTCGAGGAATTGCAGGAGGCTGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-534s21c1
Sequence:CCGGCCTGGAACACTCCATCCAGTTCTCGAGAACTGGATGGAGTGTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332759    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-855s21c1
Sequence:CCGGCTGGCTACTGACTGGCATAATCTCGAGATTATGCCAGTCAGTAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-946s21c1
Sequence:CCGGTGGGTGCAAAGGATCGTTCAACTCGAGTTGAACGATCCTTTGCACCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133731.1-344s1c1
Sequence:CCGGGCGCACTGCTTTAAGAGCAATCTCGAGATTGCTCTTAAAGCAGTGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133731.1-517s1c1
Sequence:CCGGCCTGGAACACTCCATCCAGTTCTCGAGAACTGGATGGAGTGTTCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133731.1-265s1c1
Sequence:CCGGCTGGATTGTTAGCATCCTCAACTCGAGTTGAGGATGCTAACAATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133731.1-838s1c1
Sequence:CCGGCTGGCTACTGACTGGCATAATCTCGAGATTATGCCAGTCAGTAGCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133731.2-131s21c1
Sequence:CCGGGGGACCAGTTCAGCATCTTAACTCGAGTTAAGATGCTGAACTGGTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)