EMAIL THIS PAGE TO A FRIEND

PRSS23

protease, serine, 23

166 Gene Product Result for
Synonyms: SIG13 SPUVE ZSIG13
UniProtKB ID: O95084, B2RDJ1, Q6IBI0
Gene ID:
Human(11098) Summary: This gene encodes a member of the trypsin family of serine proteases. Mouse studies found a decrease of mRNA levels after ovulation was induced. This gene seems to be highly conserved in vertebrates and may be an important ovarian protease. [provided by RefSeq, Jul 2008]
Mouse(76453) protease, serine, 23
Rat(308807) protease, serine, 23
chicken(419017) protease, serine, 23
domestic cat(101093959) protease, serine, 23
dog(485150) protease, serine, 23
cow(538575) protease, serine, 23
sheep(101102187) protease, serine, 23
naked mole-rat(101700999) protease, serine, 23
Domestic Rabbit(100342352) protease, serine, 23
domestic guinea pig(100715227) protease, serine, 23
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029614 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029614 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029614 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007173 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007173 siRNAs that have been validated in the lab human pricing
NM_001007691 Rosetta Predictions rat pricing
NM_029614 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007173 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00073933 validated 583
1 SASI_Hs01_00073934 validated 1008
1 SASI_Hs01_00073935 validated 454
2 SASI_Hs02_00343112 predicted 592
3 SASI_Hs02_00343113 predicted 1077
4 SASI_Hs01_00073937 predicted 454
5 SASI_Hs02_00343114 predicted 411
6 SASI_Hs01_00073940 predicted 366
7 SASI_Hs01_00073942 predicted 652
8 SASI_Hs02_00343115 predicted 370
9 SASI_Hs02_00343116 predicted 648
10 SASI_Hs01_00073936 predicted 968
11 SASI_Hs01_00073938 predicted 369
12 SASI_Hs01_00073939 predicted 741
13 SASI_Hs01_00073941 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030364 predicted 938
2 SASI_Rn02_00198844 predicted 911
3 SASI_Rn01_00030365 predicted 1141
4 SASI_Rn01_00030366 predicted 336
5 SASI_Rn01_00030367 predicted 382
6 SASI_Rn01_00030368 predicted 986
7 SASI_Rn01_00030369 predicted 778
8 SASI_Rn01_00030370 predicted 1160
9 SASI_Rn01_00030371 predicted 1149
10 SASI_Rn01_00030373 predicted 933
11 SASI_Rn01_00030372 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029614 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146464 predicted 1006
2 SASI_Mm01_00146465 predicted 836
3 SASI_Mm01_00146466 predicted 1205
4 SASI_Mm01_00146467 predicted 1244
5 SASI_Mm01_00146468 predicted 1331
6 SASI_Mm01_00146469 predicted 245
7 SASI_Mm01_00146470 predicted 400
8 SASI_Mm01_00146471 predicted 1222
9 SASI_Mm01_00146472 predicted 1226
10 SASI_Mm01_00146473 predicted 1199
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029614
VALIDATED
PRSS23 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 23
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029614.2-1186s1c1
Sequence:CCGGGCAGTTAGAATCACGCCTCTTCTCGAGAAGAGGCGTGATTCTAACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029614.2-238s1c1
Sequence:CCGGCCTCAGTCTACCCTCAACTTACTCGAGTAAGTTGAGGGTAGACTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029614.2-1215s1c1
Sequence:CCGGCCAGATTTGCTATTGGATTAACTCGAGTTAATCCAATAGCAAATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029614.2-692s1c1
Sequence:CCGGGCTTCCTGAAGCCCAAGTATACTCGAGTATACTTGGGCTTCAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029614.2-355s1c1
Sequence:CCGGGCCAAGCAGTACCTTTCCTATCTCGAGATAGGAAAGGTACTGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029614
VALIDATED
PRSS23 MISSION shRNA shRNA Plasmid DNA
protease, serine, 23
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029614.2-1186s1c1
Sequence:CCGGGCAGTTAGAATCACGCCTCTTCTCGAGAAGAGGCGTGATTCTAACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029614.2-238s1c1
Sequence:CCGGCCTCAGTCTACCCTCAACTTACTCGAGTAAGTTGAGGGTAGACTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029614.2-1215s1c1
Sequence:CCGGCCAGATTTGCTATTGGATTAACTCGAGTTAATCCAATAGCAAATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029614.2-692s1c1
Sequence:CCGGGCTTCCTGAAGCCCAAGTATACTCGAGTATACTTGGGCTTCAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029614.2-355s1c1
Sequence:CCGGGCCAAGCAGTACCTTTCCTATCTCGAGATAGGAAAGGTACTGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029614
VALIDATED
PRSS23 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 23
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032534    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029614.2-1186s1c1
Sequence:CCGGGCAGTTAGAATCACGCCTCTTCTCGAGAAGAGGCGTGATTCTAACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032535    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029614.2-238s1c1
Sequence:CCGGCCTCAGTCTACCCTCAACTTACTCGAGTAAGTTGAGGGTAGACTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029614.2-1215s1c1
Sequence:CCGGCCAGATTTGCTATTGGATTAACTCGAGTTAATCCAATAGCAAATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032538    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029614.2-692s1c1
Sequence:CCGGGCTTCCTGAAGCCCAAGTATACTCGAGTATACTTGGGCTTCAGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032537    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_029614.2-355s1c1
Sequence:CCGGGCCAAGCAGTACCTTTCCTATCTCGAGATAGGAAAGGTACTGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007173
VALIDATED
PRSS23 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 23
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-385s1c1
Sequence:CCGGGCCAAGCAATATCTGTCTTATCTCGAGATAAGACAGATATTGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-1243s1c1
Sequence:CCGGGCCCAGATTTGCTATTGGATTCTCGAGAATCCAATAGCAAATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-666s1c1
Sequence:CCGGCCACTGCATACACGATGGAAACTCGAGTTTCCATCGTGTATGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-307s1c1
Sequence:CCGGGCCGAAGCCAAATTAGAAGTACTCGAGTACTTCTAATTTGGCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-1041s1c1
Sequence:CCGGCGAGACCTATGACTTGCTCTACTCGAGTAGAGCAAGTCATAGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-1315s21c1
Sequence:CCGGGCCCAGATTTGCTATTGGATTCTCGAGAATCCAATAGCAAATCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-379s21c1
Sequence:CCGGGCCGAAGCCAAATTAGAAGTACTCGAGTACTTCTAATTTGGCTTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-1113s21c1
Sequence:CCGGCGAGACCTATGACTTGCTCTACTCGAGTAGAGCAAGTCATAGGTCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-738s21c1
Sequence:CCGGCCACTGCATACACGATGGAAACTCGAGTTTCCATCGTGTATGCAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-457s21c1
Sequence:CCGGGCCAAGCAATATCTGTCTTATCTCGAGATAAGACAGATATTGCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007173
VALIDATED
PRSS23 MISSION shRNA shRNA Plasmid DNA
protease, serine, 23
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-385s1c1
Sequence:CCGGGCCAAGCAATATCTGTCTTATCTCGAGATAAGACAGATATTGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-1243s1c1
Sequence:CCGGGCCCAGATTTGCTATTGGATTCTCGAGAATCCAATAGCAAATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-666s1c1
Sequence:CCGGCCACTGCATACACGATGGAAACTCGAGTTTCCATCGTGTATGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-307s1c1
Sequence:CCGGGCCGAAGCCAAATTAGAAGTACTCGAGTACTTCTAATTTGGCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000047041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-1041s1c1
Sequence:CCGGCGAGACCTATGACTTGCTCTACTCGAGTAGAGCAAGTCATAGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-1315s21c1
Sequence:CCGGGCCCAGATTTGCTATTGGATTCTCGAGAATCCAATAGCAAATCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-379s21c1
Sequence:CCGGGCCGAAGCCAAATTAGAAGTACTCGAGTACTTCTAATTTGGCTTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-1113s21c1
Sequence:CCGGCGAGACCTATGACTTGCTCTACTCGAGTAGAGCAAGTCATAGGTCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-738s21c1
Sequence:CCGGCCACTGCATACACGATGGAAACTCGAGTTTCCATCGTGTATGCAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-457s21c1
Sequence:CCGGGCCAAGCAATATCTGTCTTATCTCGAGATAAGACAGATATTGCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007173
VALIDATED
PRSS23 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 23
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-385s1c1
Sequence:CCGGGCCAAGCAATATCTGTCTTATCTCGAGATAAGACAGATATTGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-1243s1c1
Sequence:CCGGGCCCAGATTTGCTATTGGATTCTCGAGAATCCAATAGCAAATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-666s1c1
Sequence:CCGGCCACTGCATACACGATGGAAACTCGAGTTTCCATCGTGTATGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-307s1c1
Sequence:CCGGGCCGAAGCCAAATTAGAAGTACTCGAGTACTTCTAATTTGGCTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000047041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_007173.3-1041s1c1
Sequence:CCGGCGAGACCTATGACTTGCTCTACTCGAGTAGAGCAAGTCATAGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-1315s21c1
Sequence:CCGGGCCCAGATTTGCTATTGGATTCTCGAGAATCCAATAGCAAATCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291205    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-379s21c1
Sequence:CCGGGCCGAAGCCAAATTAGAAGTACTCGAGTACTTCTAATTTGGCTTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-1113s21c1
Sequence:CCGGCGAGACCTATGACTTGCTCTACTCGAGTAGAGCAAGTCATAGGTCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-738s21c1
Sequence:CCGGCCACTGCATACACGATGGAAACTCGAGTTTCCATCGTGTATGCAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007173.4-457s21c1
Sequence:CCGGGCCAAGCAATATCTGTCTTATCTCGAGATAAGACAGATATTGCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)