EMAIL THIS PAGE TO A FRIEND

PRSS27

protease, serine 27

51 Gene Product Result for
Synonyms: CAPH2 MPN
UniProtKB ID: Q9BQR3
Gene ID:
Human(83886) Summary: Pancreasin is a pancreatic tryptic serine peptidase that cleaves peptides after an arginine residue.[supplied by OMIM, Sep 2003]
Mouse(213171) protease, serine, 27
Rat(287108) protease, serine 27
domestic guinea pig(100735414) protease, serine 27
naked mole-rat(101710300) protease, serine 27
cow(521465) protease, serine 27
sheep(101117468) protease, serine 27
dog(490057) protease, serine 27
domestic cat(101101183) protease, serine 27
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175440 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175440 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175440 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031948 Rosetta Predictions human pricing
NM_182949 Rosetta Predictions rat pricing
NM_175440 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ?
1 SASI_Hs01_00022602 predicted 1153
2 SASI_Hs01_00022603 predicted 961
3 SASI_Hs01_00022604 predicted 984
4 SASI_Hs01_00022605 predicted 1172
5 SASI_Hs01_00022606 predicted 931
6 SASI_Hs01_00022607 predicted 936
7 SASI_Hs01_00022608 predicted 963
8 SASI_Hs01_00022609 predicted 851
9 SASI_Hs01_00022610 predicted 962
10 SASI_Hs01_00022611 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ?
1 SASI_Rn01_00060863 predicted 471
2 SASI_Rn01_00060866 predicted 475
3 SASI_Rn01_00060867 predicted 630
4 SASI_Rn02_00269861 predicted 295
5 SASI_Rn02_00269862 predicted 885
6 SASI_Rn01_00060870 predicted 615
7 SASI_Rn01_00060865 predicted 309
8 SASI_Rn01_00060871 predicted 723
9 SASI_Rn02_00269863 predicted 639
10 SASI_Rn02_00269864 predicted 876
11 SASI_Rn01_00060862 predicted 517
12 SASI_Rn01_00060864 predicted 454
13 SASI_Rn01_00060868 predicted 381
14 SASI_Rn01_00060869 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175440 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ?
1 SASI_Mm01_00098113 predicted 467
2 SASI_Mm01_00098114 predicted 667
3 SASI_Mm01_00098115 predicted 835
4 SASI_Mm02_00346326 predicted 642
5 SASI_Mm01_00098117 predicted 726
6 SASI_Mm01_00098118 predicted 502
7 SASI_Mm01_00098119 predicted 623
8 SASI_Mm01_00098120 predicted 825
9 SASI_Mm01_00098121 predicted 845
10 SASI_Mm01_00098122 predicted 652
11 SASI_Mm01_00098116 predicted 648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031948
PRSS27 MISSION shRNA Bacterial Glycerol Stock
protease, serine 27
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031948.3-928s21c1
Sequence:CCGGGAAACTCGCTGTGCCCATCATCTCGAGATGATGGGCACAGCGAGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031948.3-1159s21c1
Sequence:CCGGGAACCGCCCAGGTGTCTACATCTCGAGATGTAGACACCTGGGCGGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-670s1c1
Sequence:CCGGCCATCAAGAATGACATGCTGTCTCGAGACAGCATGTCATTCTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-194s1c1
Sequence:CCGGGCAAGTCAGCATCCAGCGCAACTCGAGTTGCGCTGGATGCTGACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-648s1c1
Sequence:CCGGGAGTTTGGCTACCAACCCAAACTCGAGTTTGGGTTGGTAGCCAAACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-449s1c1
Sequence:CCGGAGTGCCCTTCACCAATTACATCTCGAGATGTAATTGGTGAAGGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-857s1c1
Sequence:CCGGCAACTGGATCCATCGGATCATCTCGAGATGATCCGATGGATCCAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031948
PRSS27 MISSION shRNA shRNA Plasmid DNA
protease, serine 27
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031948.3-928s21c1
Sequence:CCGGGAAACTCGCTGTGCCCATCATCTCGAGATGATGGGCACAGCGAGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031948.3-1159s21c1
Sequence:CCGGGAACCGCCCAGGTGTCTACATCTCGAGATGTAGACACCTGGGCGGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-670s1c1
Sequence:CCGGCCATCAAGAATGACATGCTGTCTCGAGACAGCATGTCATTCTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-194s1c1
Sequence:CCGGGCAAGTCAGCATCCAGCGCAACTCGAGTTGCGCTGGATGCTGACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-648s1c1
Sequence:CCGGGAGTTTGGCTACCAACCCAAACTCGAGTTTGGGTTGGTAGCCAAACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-449s1c1
Sequence:CCGGAGTGCCCTTCACCAATTACATCTCGAGATGTAATTGGTGAAGGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-857s1c1
Sequence:CCGGCAACTGGATCCATCGGATCATCTCGAGATGATCCGATGGATCCAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031948
PRSS27 MISSION shRNA Lentiviral Transduction Particles
protease, serine 27
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031948.3-928s21c1
Sequence:CCGGGAAACTCGCTGTGCCCATCATCTCGAGATGATGGGCACAGCGAGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436215    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031948.3-1159s21c1
Sequence:CCGGGAACCGCCCAGGTGTCTACATCTCGAGATGTAGACACCTGGGCGGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-670s1c1
Sequence:CCGGCCATCAAGAATGACATGCTGTCTCGAGACAGCATGTCATTCTTGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052182    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-194s1c1
Sequence:CCGGGCAAGTCAGCATCCAGCGCAACTCGAGTTGCGCTGGATGCTGACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-648s1c1
Sequence:CCGGGAGTTTGGCTACCAACCCAAACTCGAGTTTGGGTTGGTAGCCAAACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-449s1c1
Sequence:CCGGAGTGCCCTTCACCAATTACATCTCGAGATGTAATTGGTGAAGGGCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031948.2-857s1c1
Sequence:CCGGCAACTGGATCCATCGGATCATCTCGAGATGATCCGATGGATCCAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175440
PRSS27 MISSION shRNA Bacterial Glycerol Stock
protease, serine 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-863s1c1
Sequence:CCGGCCGTGTGACTTCTCATCACAACTCGAGTTGTGATGAGAAGTCACACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-311s1c1
Sequence:CCGGCACTTCGGACATATCCATATACTCGAGTATATGGATATGTCCGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-366s1c1
Sequence:CCGGCCAGGACCACACGCCTTGTATCTCGAGATACAAGGCGTGTGGTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-570s1c1
Sequence:CCGGCCCAGTGAACAAGACCGACTACTCGAGTAGTCGGTCTTGTTCACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-470s1c1
Sequence:CCGGGCCGGTGACCTTCACCAATTACTCGAGTAATTGGTGAAGGTCACCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175440
PRSS27 MISSION shRNA shRNA Plasmid DNA
protease, serine 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-863s1c1
Sequence:CCGGCCGTGTGACTTCTCATCACAACTCGAGTTGTGATGAGAAGTCACACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-311s1c1
Sequence:CCGGCACTTCGGACATATCCATATACTCGAGTATATGGATATGTCCGAAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-366s1c1
Sequence:CCGGCCAGGACCACACGCCTTGTATCTCGAGATACAAGGCGTGTGGTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-570s1c1
Sequence:CCGGCCCAGTGAACAAGACCGACTACTCGAGTAGTCGGTCTTGTTCACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-470s1c1
Sequence:CCGGGCCGGTGACCTTCACCAATTACTCGAGTAATTGGTGAAGGTCACCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175440
PRSS27 MISSION shRNA Lentiviral Transduction Particles
protease, serine 27
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-863s1c1
Sequence:CCGGCCGTGTGACTTCTCATCACAACTCGAGTTGTGATGAGAAGTCACACGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-311s1c1
Sequence:CCGGCACTTCGGACATATCCATATACTCGAGTATATGGATATGTCCGAAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-366s1c1
Sequence:CCGGCCAGGACCACACGCCTTGTATCTCGAGATACAAGGCGTGTGGTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-570s1c1
Sequence:CCGGCCCAGTGAACAAGACCGACTACTCGAGTAGTCGGTCTTGTTCACTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175440.2-470s1c1
Sequence:CCGGGCCGGTGACCTTCACCAATTACTCGAGTAATTGGTGAAGGTCACCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)