EMAIL THIS PAGE TO A FRIEND

PRSS30P

protease, serine, 30, pseudogene

45 Gene Product Result for
Synonyms: Disp TMPRSS8 TMPRSS8P
Species: Human PRSS30P(124221)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1408278 Anti-MGC52282 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178453 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178453 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178453 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178453 Rosetta Predictions human pricing
XR_039869 Rosetta Predictions human pricing
XR_039870 Rosetta Predictions human pricing
XR_039871 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178453 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184522 predicted 447
2 SASI_Hs01_00184523 predicted 477
3 SASI_Hs01_00184524 predicted 295
4 SASI_Hs01_00184525 predicted 423
5 SASI_Hs01_00184526 predicted 372
6 SASI_Hs01_00184527 predicted 325
7 SASI_Hs01_00184528 predicted 433
8 SASI_Hs01_00184529 predicted 462
9 SASI_Hs01_00184530 predicted 423
10 SASI_Hs01_00184531 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513832 predicted 738
2 SASI_Hs02_00513833 predicted 754
3 SASI_Hs02_00513834 predicted 707
4 SASI_Hs02_00513835 predicted 557
5 SASI_Hs02_00513836 predicted 664
6 SASI_Hs02_00513837 predicted 521
7 SASI_Hs02_00513838 predicted 255
8 SASI_Hs02_00513839 predicted 514
9 SASI_Hs02_00513840 predicted 275
10 SASI_Hs02_00513841 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513842 predicted 729
2 SASI_Hs02_00513843 predicted 754
3 SASI_Hs02_00513844 predicted 707
4 SASI_Hs02_00513845 predicted 553
5 SASI_Hs02_00513846 predicted 656
6 SASI_Hs02_00513847 predicted 518
7 SASI_Hs02_00513848 predicted 253
8 SASI_Hs02_00513849 predicted 513
9 SASI_Hs02_00513850 predicted 284
10 SASI_Hs02_00513851 predicted 270
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039871 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513852 predicted 736
2 SASI_Hs02_00513853 predicted 761
3 SASI_Hs02_00513854 predicted 707
4 SASI_Hs02_00513855 predicted 553
5 SASI_Hs02_00513856 predicted 660
6 SASI_Hs02_00513857 predicted 518
7 SASI_Hs02_00513858 predicted 253
8 SASI_Hs02_00513859 predicted 514
9 SASI_Hs02_00513860 predicted 279
10 SASI_Hs02_00513861 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178453
PRSS30P MISSION shRNA Bacterial Glycerol Stock
protease, serine, 30, pseudogene
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000074032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-489s1c1
Sequence:CCGGGAATCTCACTCAGGCATGTCTCTCGAGAGACATGCCTGAGTGAGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-446s1c1
Sequence:CCGGCCAGGTGCTAAGCTACACAGACTCGAGTCTGTGTAGCTTAGCACCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-363s1c1
Sequence:CCGGCCCATCAATGATACGTGGATCCTCGAGGATCCACGTATCATTGATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-471s1c1
Sequence:CCGGATTCAGAGAACCCTGGCTGAACTCGAGTTCAGCCAGGGTTCTCTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178453
PRSS30P MISSION shRNA shRNA Plasmid DNA
protease, serine, 30, pseudogene
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000074032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-489s1c1
Sequence:CCGGGAATCTCACTCAGGCATGTCTCTCGAGAGACATGCCTGAGTGAGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-446s1c1
Sequence:CCGGCCAGGTGCTAAGCTACACAGACTCGAGTCTGTGTAGCTTAGCACCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-363s1c1
Sequence:CCGGCCCATCAATGATACGTGGATCCTCGAGGATCCACGTATCATTGATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-471s1c1
Sequence:CCGGATTCAGAGAACCCTGGCTGAACTCGAGTTCAGCCAGGGTTCTCTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178453
PRSS30P MISSION shRNA Lentiviral Transduction Particles
protease, serine, 30, pseudogene
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000074032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-489s1c1
Sequence:CCGGGAATCTCACTCAGGCATGTCTCTCGAGAGACATGCCTGAGTGAGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-446s1c1
Sequence:CCGGCCAGGTGCTAAGCTACACAGACTCGAGTCTGTGTAGCTTAGCACCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-363s1c1
Sequence:CCGGCCCATCAATGATACGTGGATCCTCGAGGATCCACGTATCATTGATGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178453.2-471s1c1
Sequence:CCGGATTCAGAGAACCCTGGCTGAACTCGAGTTCAGCCAGGGTTCTCTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)