EMAIL THIS PAGE TO A FRIEND

PRSS33

protease, serine, 33

77 Gene Product Result for
Synonyms: EOS
UniProtKB ID: Q8NF86, A6NNQ3, Q8N171
Gene ID:
Mouse(353130) protease, serine, 33
Rat(497873) protease, serine, 33
cow(528784) protease, serine, 33
domestic guinea pig(100734196) protease, serine, 33
naked mole-rat(101712128) protease, serine, 33
dog(490053) protease, serine, 33
domestic cat(101099923) protease, serine, 33
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152891 Rosetta Predictions human pricing
NM_001109027 Rosetta Predictions rat pricing
NM_001081399 Rosetta Predictions mouse pricing
XM_895929 Rosetta Predictions mouse pricing
XM_978060 Rosetta Predictions mouse pricing
XM_978096 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366857 predicted 273
2 SASI_Hs01_00230879 predicted 301
3 SASI_Hs02_00366858 predicted 277
4 SASI_Hs01_00230886 predicted 250
5 SASI_Hs01_00230880 predicted 856
6 SASI_Hs02_00366859 predicted 220
7 SASI_Hs01_00230881 predicted 773
8 SASI_Hs01_00230882 predicted 1204
9 SASI_Hs01_00230883 predicted 1302
10 SASI_Hs02_00366860 predicted 1309
11 SASI_Hs01_00230884 predicted 1128
12 SASI_Hs01_00230885 predicted 1104
13 SASI_Hs01_00230887 predicted 327
14 SASI_Hs01_00230888 predicted 853
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244454 predicted 862
2 SASI_Rn02_00244455 predicted 220
3 SASI_Rn02_00244456 predicted 629
4 SASI_Rn02_00244457 predicted 846
5 SASI_Rn02_00244458 predicted 859
6 SASI_Rn02_00244459 predicted 972
7 SASI_Rn02_00244460 predicted 381
8 SASI_Rn02_00244461 predicted 984
9 SASI_Rn02_00244462 predicted 291
10 SASI_Rn02_00244463 predicted 649
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081399 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00298011 predicted 1056
2 SASI_Mm02_00298012 predicted 679
3 SASI_Mm02_00298013 predicted 638
4 SASI_Mm02_00298014 predicted 1044
5 SASI_Mm02_00298015 predicted 435
6 SASI_Mm02_00298016 predicted 673
7 SASI_Mm02_00298017 predicted 404
8 SASI_Mm02_00298018 predicted 364
9 SASI_Mm02_00298019 predicted 397
10 SASI_Mm02_00298020 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895929 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00249103 predicted 728
2 SASI_Mm01_00249104 predicted 725
3 SASI_Mm01_00249105 predicted 475
4 SASI_Mm01_00249106 predicted 393
5 SASI_Mm01_00249107 predicted 392
6 SASI_Mm01_00249108 predicted 730
7 SASI_Mm01_00249109 predicted 763
8 SASI_Mm01_00249110 predicted 742
9 SASI_Mm01_00249111 predicted 735
10 SASI_Mm01_00249112 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00209461 predicted 439
2 SASI_Mm01_00209462 predicted 378
3 SASI_Mm01_00209463 predicted 400
4 SASI_Mm01_00209464 predicted 437
5 SASI_Mm01_00209465 predicted 447
6 SASI_Mm01_00209466 predicted 410
7 SASI_Mm01_00209467 predicted 367
8 SASI_Mm01_00209468 predicted 459
9 SASI_Mm01_00209469 predicted 452
10 SASI_Mm01_00209470 predicted 396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978096 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229745 predicted 631
2 SASI_Mm01_00229746 predicted 625
3 SASI_Mm01_00229747 predicted 386
4 SASI_Mm01_00229748 predicted 304
5 SASI_Mm01_00229749 predicted 297
6 SASI_Mm01_00229750 predicted 632
7 SASI_Mm01_00229751 predicted 660
8 SASI_Mm01_00229752 predicted 649
9 SASI_Mm01_00229753 predicted 642
10 SASI_Mm01_00229754 predicted 316
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152891
PRSS33 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 33
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-608s1c1
Sequence:CCGGACAAGGAGTAAGGGTGCCGCTCTCGAGAGCGGCACCCTTACTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152891.2-949s21c1
Sequence:CCGGCTACACCAGTGTGGCCACATACTCGAGTATGTGGCCACACTGGTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-162s1c1
Sequence:CCGGCGCATGTCCAGTCGGATCGTTCTCGAGAACGATCCGACTGGACATGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-824s1c1
Sequence:CCGGCAAGGGTTGTGCCCTGCCCAACTCGAGTTGGGCAGGGCACAACCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-895s1c1
Sequence:CCGGCTCGCGTCACTTCTAATGCTACTCGAGTAGCATTAGAAGTGACGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152891.1-1296s1c1
Sequence:CCGGGAGATTTGACACCAGGGAGATCTCGAGATCTCCCTGGTGTCAAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152891.2-218s21c1
Sequence:CCGGACTCAGGGAAGGAAGTCTGCACTCGAGTGCAGACTTCCTTCCCTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152891.2-1357s21c1
Sequence:CCGGTTTCTGGAGAAAGTCAGATTCCTCGAGGAATCTGACTTTCTCCAGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152891
PRSS33 MISSION shRNA shRNA Plasmid DNA
protease, serine, 33
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-608s1c1
Sequence:CCGGACAAGGAGTAAGGGTGCCGCTCTCGAGAGCGGCACCCTTACTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152891.2-949s21c1
Sequence:CCGGCTACACCAGTGTGGCCACATACTCGAGTATGTGGCCACACTGGTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-162s1c1
Sequence:CCGGCGCATGTCCAGTCGGATCGTTCTCGAGAACGATCCGACTGGACATGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-824s1c1
Sequence:CCGGCAAGGGTTGTGCCCTGCCCAACTCGAGTTGGGCAGGGCACAACCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-895s1c1
Sequence:CCGGCTCGCGTCACTTCTAATGCTACTCGAGTAGCATTAGAAGTGACGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152891.1-1296s1c1
Sequence:CCGGGAGATTTGACACCAGGGAGATCTCGAGATCTCCCTGGTGTCAAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152891.2-218s21c1
Sequence:CCGGACTCAGGGAAGGAAGTCTGCACTCGAGTGCAGACTTCCTTCCCTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152891.2-1357s21c1
Sequence:CCGGTTTCTGGAGAAAGTCAGATTCCTCGAGGAATCTGACTTTCTCCAGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152891
PRSS33 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 33
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-608s1c1
Sequence:CCGGACAAGGAGTAAGGGTGCCGCTCTCGAGAGCGGCACCCTTACTCCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152891.2-949s21c1
Sequence:CCGGCTACACCAGTGTGGCCACATACTCGAGTATGTGGCCACACTGGTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-162s1c1
Sequence:CCGGCGCATGTCCAGTCGGATCGTTCTCGAGAACGATCCGACTGGACATGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074017    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-824s1c1
Sequence:CCGGCAAGGGTTGTGCCCTGCCCAACTCGAGTTGGGCAGGGCACAACCCTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152891.1-895s1c1
Sequence:CCGGCTCGCGTCACTTCTAATGCTACTCGAGTAGCATTAGAAGTGACGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074013    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152891.1-1296s1c1
Sequence:CCGGGAGATTTGACACCAGGGAGATCTCGAGATCTCCCTGGTGTCAAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378962    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152891.2-218s21c1
Sequence:CCGGACTCAGGGAAGGAAGTCTGCACTCGAGTGCAGACTTCCTTCCCTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373257    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152891.2-1357s21c1
Sequence:CCGGTTTCTGGAGAAAGTCAGATTCCTCGAGGAATCTGACTTTCTCCAGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178370
PRSS33 MISSION shRNA Bacterial Glycerol Stock
protease, serine, 33
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000032381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-636s1c1
Sequence:CCGGCATAGTGCTACCAGGGAACTTCTCGAGAAGTTCCCTGGTAGCACTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-519s1c1
Sequence:CCGGCCCAGGAGTACCACTCCCAAACTCGAGTTTGGGAGTGGTACTCCTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-159s1c1
Sequence:CCGGGTGGCAAACAAGCATTCAGCACTCGAGTGCTGAATGCTTGTTTGCCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-233s1c1
Sequence:CCGGCGGCAGGTCACTGTTTCCCTACTCGAGTAGGGAAACAGTGACCTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-785s1c1
Sequence:CCGGCCAACCGTCCAGGTGTCTATACTCGAGTATAGACACCTGGACGGTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178370
PRSS33 MISSION shRNA shRNA Plasmid DNA
protease, serine, 33
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000032381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-636s1c1
Sequence:CCGGCATAGTGCTACCAGGGAACTTCTCGAGAAGTTCCCTGGTAGCACTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-519s1c1
Sequence:CCGGCCCAGGAGTACCACTCCCAAACTCGAGTTTGGGAGTGGTACTCCTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-159s1c1
Sequence:CCGGGTGGCAAACAAGCATTCAGCACTCGAGTGCTGAATGCTTGTTTGCCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-233s1c1
Sequence:CCGGCGGCAGGTCACTGTTTCCCTACTCGAGTAGGGAAACAGTGACCTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000032380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-785s1c1
Sequence:CCGGCCAACCGTCCAGGTGTCTATACTCGAGTATAGACACCTGGACGGTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178370
PRSS33 MISSION shRNA Lentiviral Transduction Particles
protease, serine, 33
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000032381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-636s1c1
Sequence:CCGGCATAGTGCTACCAGGGAACTTCTCGAGAAGTTCCCTGGTAGCACTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-519s1c1
Sequence:CCGGCCCAGGAGTACCACTCCCAAACTCGAGTTTGGGAGTGGTACTCCTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-159s1c1
Sequence:CCGGGTGGCAAACAAGCATTCAGCACTCGAGTGCTGAATGCTTGTTTGCCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-233s1c1
Sequence:CCGGCGGCAGGTCACTGTTTCCCTACTCGAGTAGGGAAACAGTGACCTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000032380    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178370.2-785s1c1
Sequence:CCGGCCAACCGTCCAGGTGTCTATACTCGAGTATAGACACCTGGACGGTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)